1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
13

HElp pLEASE!! I will give POints and THANKS! By the way it’s QUESTION 6!

Biology
2 answers:
grigory [225]3 years ago
7 0

Answer:

A)

Explanation:

the process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a byproduct.Also During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make SUGAR molecules and oxygen. These sugar molecules are the basis for more complex molecules made by the photosynthetic cell, such as GLUCOSE.

therefore the answer would be A

lidiya [134]3 years ago
5 0

Answer:

A.

Explanation:

You might be interested in
A farmer uses genetic engineering to inject dairy cows with a genetically altered hormone (GAH) to result in the production of m
a_sh-v [17]

Answer:.Use of the GAH may increase the amount of hormones in the milk.

Explanation:The increased amount of hormones could cause unintended transmission of the genetically altered hormone or related hormones to be present in the milk.

6 0
4 years ago
Read 2 more answers
Elements are___
meriva
Substances that are made up of only one type of atom.
7 0
3 years ago
What are three characteristics used to describe soil?
denis23 [38]

A soil is described in terms of its fertility, texture, and pH level. Could I have Brainliest?

7 0
3 years ago
Read 2 more answers
There are 4,000 units of energy available to grass at the first trophic level of an ecosystem. If the grass is eaten by a mouse
labwork [276]
There would be 40 units of energy left, because 10% is lost each time.
4 0
3 years ago
Could two parents with cleft-chin have a child without cleft-chin?
Mnenie [13.5K]

Answer:Cleft chins were believed to be a dominant trait: if two parents had cleft chins, their kids could have a cleft or might not  But it turns out a cleft chin is too complicated to be simply dominant. Two parents without a cleft have kids with cleft chins way more often than predicted with this simple model.

Explanation:

7 0
3 years ago
Other questions:
  • By controlling the substances that enter and leave the cell, the cell membrane helps maintain homeostasis in the cell.
    10·2 answers
  • Tell me please where is digestion of protein complete​
    13·1 answer
  • In chickens, the allele for feathered legs (F) is dominant over the allele for bare legs (f). In a population of chickens on a f
    12·1 answer
  • Why does dna rely on rna?Why can’t dna deliver the instructions to the ribosomes directly
    15·1 answer
  • Most cells are constantly replacing damaged molecules and organelles. Explain why a red blood cell is unable to replace damaged
    6·1 answer
  • How were fossils of plants found in antarctica
    12·1 answer
  • How would you change this setup so that the Shallow sensor does not break but still sends important information? (Remember: We s
    6·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Justify your choice by writing a hypothesis to explain how it has stopped the algae from making ATP, NADPH and sugars. You will
    10·1 answer
  • F today's first high tide is at 7:00 AM, what time will today's next high tide be?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!