I believe it is A
Please make this the brainliest answer
Answer:
They are veins and arteries. The primary function of arteries is to transport highly oxygenated, nutrient-rich blood from our hearts and distribute it to the rest of our body. Veins, on the other hand, are used to pump much-needed blood back to the heart.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
All of the answer options are correct.
Explanation:
Chargaff contributed in understanding the structure and composition of DNA with his discoveries. He discovered that purine and pyrimidine bases are in equal amounts in a DNA molecule. He also discovered that amount of Adenine base (A) is equal to amount of Thymine base (T). It means that A pairs with T. Since A is a purine and T is a pyrimidine it also implies that purine base pairs with a pyrimidine base. This conclusion can also be arrived by taking in consideration the other base pair which is G (purine) and C (pyrimidine).
Answer:water and sugar(also known as glucose)
Explanation:During the process of photosynthesis plants break apart the reactants of carbon dioxide and water and recombine them to produce oxygen(o2) and a form of sugar called glucose (C6H12O6)
