1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amanda [17]
3 years ago
11

What type of chemical bonds would expect to find in ionic compounds ?

Biology
1 answer:
Natali [406]3 years ago
8 0

Answer:

It is a type of chemical bond that generates two oppositely charged ions. In ionic bonds, the metal loses electrons to become a positively charged cation, whereas the nonmetal accepts those electrons to become a negatively charged anion.

Explanation:

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
The chemical reaction below represents a metabolic process.
ANEK [815]
Photosynthesis uses carbon and h20 as the reactants
7 0
3 years ago
Create a food web with the following organisms. Utilize the internet to identify the organisms as producer, herbivore, carnivore
Diano4ka-milaya [45]

Answer:

Hope this helps!!!!!!

4 0
3 years ago
Why can't cellular respiration occur without photosynthesis? (2 points)
Anna35 [415]

Answer:

d

Explanation:

8 0
3 years ago
Fermentation and aerobic respiration break down glucose to make
Eddi Din [679]

Answer:

D

Explanation:

Fermentation produces a net gain of 2 ATPs

Aerobic respiration produces a net gain of 32 ATPs

6 0
3 years ago
Other questions:
  • (1) Many American men were drafted during World War II. (2) Many other men volunteered to serve. (3) In fact, so many men entere
    15·1 answer
  • What part of the conduction system might be at risk for abnormalities with vsd?
    15·1 answer
  • What is NOT a part of Translation
    5·1 answer
  • Explain what air pressure indicates with weather
    9·1 answer
  • The major source of energy for all things comes from
    13·2 answers
  • ___________ control all chemical reactions including metabolic processes like photosynthesis and cellular respiration
    10·1 answer
  • Granite is a coarse or medium-grained rock that is rich in quartz and feldspar. It is formed when bodies of magma cool and harde
    10·1 answer
  • Describe the ways mutations can affect DNA and chromosomes.​
    7·1 answer
  • HELP ASAP!! 2 MINUTES!! I'll give brainliest and points and thanks if you get it right.if you do 1 I’ll give you a thanks, if yo
    13·1 answer
  • 2. What has happened to the level of carbon dioxide in the atmosphere in the past several
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!