Answer:
According to the number of sequence on DNA there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.
Explanation:
DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-
GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-
GAG UUU AUC CCC AAC UUG GCA UAA GGU AGG-
Glutamine, Phenylalanine, Isoleusine, Proline, Asparagine , Leucine, Alanine, stop codon. As ribosome reach on stop codon protein synthesis stopped and process aborted.
Answer:
Smooth muscle is found in the walls of hollow organs like your intestines and stomach. They work automatically without you being aware of them. Smooth muscles are involved in many 'housekeeping' functions of the body. The muscular walls of your intestines contract to push food through your body.
Explanation:
Star is a brilliantly glowing sphere of hot gas whose energyis produced by an internalnuclear fusion process. Stars are contained in galaxies. A galaxy contains not only stars, but clouds of gas and dust. These clouds are callednebulae, and it is in a nebula where stars are born. In the nebula is hydrogen gas which is pulled together by gravityand starts to spin faster. Over millions of years, more hydrogen gas is pulled into the spinning cloud. The collisions which occur between the hydrogen atoms starts to heat the gas in the cloud. Once the temperature reaches 15,000,000 degrees Celsius, nuclear fusion takes place in the center, or core, of the cloud. The tremendous heat given off by the nuclear fusion process causes the gas to glow creating a protostar. This is the first step in the evolution of a star. The glowing protostar continues to accumulate mass. The amount of mass it can accumulate is determined by the amount ofmatter available in the nebula. Once its mass is stabilized, the star is known as a main sequence star. The new star will continue to glow for millions or even billions of years. As it glows, hydrogen is converted into helium in the core by nuclear fusion. The core starts to become unstable and it starts to contract. The outer shell of the star, which is still mostly hydrogen, starts to expand. As it expands, it cools and starts to glow red. The star has now reached the red giant phase. It is red because it is cooler than the protostar phase and it is a giant because the outer shell has expanded outward. All stars evolve the same way up to the red giant phase. The amount of mass a star has determines which of the following life cycle paths the star will take.
The answer is C.
<span>Carbohydrates acts as source of energy for the body
glucose and a store of energy or starch in plants</span>
A.) ethical is a concern raised
