Question

An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3'

Answer 1

Answer: Thecorrect answer would be

3' GGGAACCTTGATGTTTCGGCTCTAATT 5'

Explanation:

DNA and RNA are nucleic acids, that is, polymers of nucleotide. DNA consists of adenine, guanine, cytosine, and thymine. In contrast, RNA contains uracil in place of thymine. Rest three nucleotide are same.

Please note that transcription (DNA to RNA) as well as reverse transcription (RNA to DNA) is done on the basis of base complementary nature.

The base pairs are:

• adenine- thymine/uracil
• guanine- cytosine

So, if adenine is present in DNA then uracil will be incorporated in RNA and vice-versa.

For example, the initial 5 nucleotide of given RNA are 5' CCCUU...3'

So, in DNA, based on base complementary rule, G will be incorporated against C and A will be incorporated against U. Thus, the DNA sequence would be 3' GGGAA...5'.

Similarly, the whole sequence can be worked out.