1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
5

An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence o

f bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3'
Biology
1 answer:
miv72 [106K]3 years ago
3 0

Answer: Thecorrect answer would be

3' GGGAACCTTGATGTTTCGGCTCTAATT 5'

Explanation:

DNA and RNA are nucleic acids, that is, polymers of nucleotide. DNA consists of adenine, guanine, cytosine, and thymine. In contrast, RNA contains uracil in place of thymine. Rest three nucleotide are same.

Please note that transcription (DNA to RNA) as well as reverse transcription (RNA to DNA) is done on the basis of base complementary nature.

The base pairs are:

  • adenine- thymine/uracil
  • guanine- cytosine

So, if adenine is present in DNA then uracil will be incorporated in RNA and vice-versa.

For example, the initial 5 nucleotide of given RNA are 5' CCCUU...3'

So, in DNA, based on base complementary rule, G will be incorporated against C and A will be incorporated against U. Thus, the DNA sequence would be 3' GGGAA...5'.

Similarly, the whole sequence can be worked out.

You might be interested in
Where is most of a healthy persons fat stored
nalin [4]
Triglycerides, from what I remember.
 
6 0
3 years ago
Read 2 more answers
Data from several papers by chargaff: for example,
jeka94
YES.The distribution of bases in sea urchin DNA and salmon DNA follow Chargaff's rules because the percentage of A bases is approximately equal to the percentage of T bases, and also the percentage of G bases is approximately equals to the percentage of C bases in both species. According to Chargaff's rule the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine. 
5 0
4 years ago
The process in which dna is transferred to or taken up by another organism is called translation.
Anuta_ua [19.1K]
I think the correct answer would be false. The process in which dna is transferred to or taken up by another organism is not translation. This is because t<span>he process of translation can be seen as the decoding of instructions for making proteins, involving mRNA in transcription as well as tRNA.</span>
5 0
3 years ago
What are some ides you have heard of for climate change
GenaCL600 [577]

Answer:

Ans:

Explanation:

Make your voice heard by those in power. ...

Eat less meat and dairy. ...

Cut back on flying. ...

Leave the car at home. ...

Reduce your energy use, and bills. ...

Respect and protect green spaces. ...

Invest your money responsibly. ...

Cut consumption – and waste.

hope it helps ....please mark brainliest

8 0
2 years ago
What type of intercellular junction bands together adjacent cells, making the epidermis stronger?.
fenix001 [56]

Answer:

Tight or occluding junctions This type of junction is also called zonula occludens and is the most apical structure in the epithelial cell. Zonula occludens describes, that there is a formed band of tight junctions which encircles every cell.

Explanation:

8 0
2 years ago
Other questions:
  • Which of the following would not support Darwin's research leading to the theory of natural selection? vestigial structures are
    14·2 answers
  • What are greenhouse gases?
    15·2 answers
  • Which letter indicates the wavelength of the wave?
    12·1 answer
  • What affects the size of an angle?
    14·1 answer
  • use the dichotomous key to classify the plant seen here. A) White oak B) White fir C) Douglas fir D) Common juniper
    9·2 answers
  • Explain climate change in the past 100 years
    10·1 answer
  • (Moves out of nucleus to cytoplasm) DNA or RNA
    8·1 answer
  • Assuming that a person going to community college can't afford to go to a four-year college is an example of a) a generalization
    11·1 answer
  • Explain briefly George Wofan's hypothesis about the origin of the earth.​
    10·1 answer
  • How are the three stages of photosynthesis linked?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!