1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
5

An RNA virus that infects plant cells is copied into a DNA molecule after it enters the plant cell. What would be the sequence o

f bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5' CCCUUGGAACUACAAAGCCGAGAUUAA 3'
Biology
1 answer:
miv72 [106K]3 years ago
3 0

Answer: Thecorrect answer would be

3' GGGAACCTTGATGTTTCGGCTCTAATT 5'

Explanation:

DNA and RNA are nucleic acids, that is, polymers of nucleotide. DNA consists of adenine, guanine, cytosine, and thymine. In contrast, RNA contains uracil in place of thymine. Rest three nucleotide are same.

Please note that transcription (DNA to RNA) as well as reverse transcription (RNA to DNA) is done on the basis of base complementary nature.

The base pairs are:

  • adenine- thymine/uracil
  • guanine- cytosine

So, if adenine is present in DNA then uracil will be incorporated in RNA and vice-versa.

For example, the initial 5 nucleotide of given RNA are 5' CCCUU...3'

So, in DNA, based on base complementary rule, G will be incorporated against C and A will be incorporated against U. Thus, the DNA sequence would be 3' GGGAA...5'.

Similarly, the whole sequence can be worked out.

You might be interested in
Que tipo de aislamiento reproductivo exhibe la mula?
bulgar [2K]

Answer:

<em>Aislamiento postreproductivo: Esterilidad del híbrido</em>

Explanation:

El concepto biológico de <u>especie</u>, en su definición, destaca que los ejemplares de una especie no pueden entrecruzarse con ejemplares de otra especie distinta, o bien, en caso de hacerlo, no hay éxito reproductivo.

Existen distintos mecanismos de aislamiento reproductivo, que son barreras que inhiben o interrumpen el flujo génico entre especies distintas. Se trata de caracteres biológicos propios de cada especie que previenen la reproducción con otras especies.

Estos mecanismos de aislamiento reproductivo pueden ser precigóticos o postcigóticos.  

  1. Pre-copulatorios o pre-cigóticos:
  • Ecológico o por aislamiento de hábitat;
  • Estacional o temporal;
  • Sexual o etológico;
  • Mecánico;
  • Por incompatibilidad de gametas.  

   2. Post-copulatorios o cigóticos:

  • Inviabilidad del híbrido;
  • Esterilidad del híbrido;
  • Híbrido con viabilidad o fertilidad disminuido;
  • Interacciones citoplasmáticas.

La mula es producto de la cruza entre dos especies distintas: una yegua (<em>Equus ferus caballus</em>) y un burro (<em>Equus africanus asinus</em>). Es un ejemplo de la accion de mecanismo poscigótico, en el cual se forma un híbrido viable esteril. Este ejemplar puede nacer crecer y sobrevivir, pero que no pueden producir gametas funcionales, por lo cual no pueden reproducirse.        

4 0
3 years ago
Water and minerals are absorbed into the blood in the
netineya [11]

Water and minerals are absorbed into the blood in the colon of the large intestine.

6 0
3 years ago
A mountain chain of sedimentary rock may form as a result of a convergent boundary of two continental crusts
ch4aika [34]
The answer is to this question is True.
4 0
3 years ago
In order to support his theory of evolutionary change, Charles Darwin concentrated his studies on the many species of finches in
ale4655 [162]

I think the answer would be c. because for birds with longer beaks, it was easier to eat seeds off a cactus (for example), and for birds with shorter seeds, it was easier to eat seeds off the ground.

4 0
3 years ago
Read 2 more answers
G.i.r.ls in.tres.ted i.n vid.eo se.x j.oin now.<br>jrj-kfng-vcu​
salantis [7]

Answer:

info Incorrect

Explanation:

info Incorrect

5 0
3 years ago
Read 2 more answers
Other questions:
  • Where does a consumers energy come from?
    9·1 answer
  • "which type of plants keep their stomata open at night, but closed in the day?"
    12·1 answer
  • During meiosis, the original reproductive cell produces four daughter cells. How many daughter cells will be produced if 250 mou
    12·1 answer
  • You discover a genus of lizards that contains two extinct species and five living species. The oldest fossils from the genus bel
    10·1 answer
  • What do we call a relationship between
    12·2 answers
  • Pls help i’ll give you brainliest answer
    6·1 answer
  • What type of rock forms when magma cools?
    5·2 answers
  • Without genetic _____, natural selection could not occur. <br> A) variation <br> B) sameness
    9·1 answer
  • Acklarmisiniz soruyu​
    10·1 answer
  • at which level of biological organization does muscle tissue and nervous tissues work together to carry out a specific function?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!