1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
7

Amal was on a picnic to Hatta with his parents and family friends. While playing, he collected some muddy water from the Wadi in

his beaker, which he wanted to make pure and clean. A) What do you think will happen to the mud in his beaker if left overnight? B) What is this process called?
Biology
1 answer:
BaLLatris [955]3 years ago
4 0

Answer:

See the answers below

Explanation:

A) <u>The mud in Amal's beaker will settle down at the bottom of the muddy water if left overnight with clear water occupying the surface.</u> This is because the particles of mud are insoluble in water and will settle down at the bottom of the muddy water if left undisturbed for a while.

B) The process is called sedimentation. The settled mud particles are referred to as the sediments and the clear water at the top can be decanted off to separate the sediment from the water.

You might be interested in
It uses the ___ ___ and ___ given off by ANIMALS along with _____ to create ___.
Butoxors [25]
Can u show me the page ?
3 0
3 years ago
The united states , canada , japan , and england are all examples of ?
Mars2501 [29]
1. developed nations
4 0
3 years ago
Martha has a widow's peak (dominant trait) and attached earlobes (recessive trait). Martha's dad had a straight hairline and una
Readme [11.4K]

Answer:

3/8

Explanation:

Martha has a widow's peak (dominant trait) and attached earlobes (recessive trait).

Martha's dad had a straight hairline (ww) and unattached earlobes (Ee, because she has the recessive alleles ee and both parents give us one allele).

This tells you that martha has a mother with at least one of both alleles dominant for widow peak and at least one recesive allele of attached earlobes

So, martha's alleles are: Ww and ee.

If she marries a man that is heterozygous for both traits (Ww and Ee) the probabilitys are

Ww Ee x Ww ee: WWEe, WwEe, wWee, and wwee

8 0
3 years ago
Which option is it? Please help
Nat2105 [25]

Answer:

The correct anwser is D. Signals inside the spinal cord

Explanation:

hope this helps :)

7 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Other questions:
  • Know all STIS: pathophysiology, etiology, clinical manifestations, diagnostic tests, treatment, and complications. How is each t
    12·1 answer
  • PLEASE HELP ILL GIVE BRAINLIEST
    6·1 answer
  • Solid rock that is exposed to extreme temperature,pressure,or chemical fluids becomes...
    9·1 answer
  • Complete the chart please
    5·1 answer
  • What is the amino acid sequence resulting from this section mRNA?
    12·2 answers
  • Which organisms are both heterotrophic and autotrophic
    5·2 answers
  • I don't really understand it, so can you help? thank you! ​
    12·1 answer
  • The picture above shows a microscopic view of an animal cell. Which of the following is an observation that can be made about th
    7·1 answer
  • What act as a root in the pteridophytes ​
    12·2 answers
  • The cell you are examining under the microscope appears to contain a nucleus. This organism belongs to the domain:________
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!