1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
9

where can transcription and translation happen that is neither the cytoplasm nor the nucleus? And explain why.

Biology
1 answer:
xeze [42]3 years ago
4 0

Answer:

We turn now to transcription in eukaryotes, a much more complex process than in prokaryotes. In eukaryotes, transcription and translation take place in different cellular compartments: transcription takes place in the membrane-bounded nucleus, whereas translation takes place outside the nucleus in the cytoplasm.

You might be interested in
Which ions are important for establishing the resting potential in neurons?
tia_tia [17]
Sodium, potassium, chloride and calcium ions are important for establishing the resting potential of the cell. The sodium-potassium gradient is maintained by a pump which transports 2 potassium inside the cell and 3 sodium ions outside the cell. 
3 0
3 years ago
All sensory information, with the exception of olfaction, must pass though the ________ as it travels to the cerebral cortex. ce
Whitepunk [10]

Answer:

\huge\boxed{\sf Thalamus}

Explanation:

All the sensory information through sensory neurons must pass through the thalamus.

<u>Thalamus:</u>

  • connects cerebral cortex and midbrain.
  • collects information from the midbrain and passes it to the cerebral cortex.
  • is involved in more functions such as; detects sensations of visual, auditory, and gustatory systems.
  • is concerned with memory, emotions.

\rule[225]{225}{2}

7 0
3 years ago
Which definition is the best for “semipermeable membrane
blondinia [14]

Answer: A semi-permeable membrane is that which only allows certain

               substances to pass through.

7 0
2 years ago
Read 2 more answers
Based on the picture above, if someone has two X chromosomes, they would genetically be considered
ivann1987 [24]
Women have XX chromosomes and Men have XY
BLANK 1: Male
BLANK 2: Female
5 0
3 years ago
Which of these best describes extinction events?
SpyIntel [72]

Answer: D. Extinctions occur at higher rates during times of ecological stress when populations and species are poorly adapted.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which cycle depends on evaporation
    12·2 answers
  • Which of the following statements best describes what happens when a bacterial cell is placed in a solution containing 5 percent
    14·1 answer
  • The immune system is the body's defense against disease. White blood cells, or lymphocytes, are one type of immune system cell.
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What are unicellular prokaryotes that live in dust?
    5·1 answer
  • Social mobility that occurs over the course of an individual's lifetime is called ________ mobility.
    10·1 answer
  • Enzymes in the mouth, stomach, and small intestine help in the chemical digestion of food.
    14·1 answer
  • In terms of density and humidity, which conditions characterize a high-pressure area?
    7·1 answer
  • Which is one way that analyzing ice benefits scientists who study ancient climates?
    12·1 answer
  • A population of wolves that lives
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!