1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
3 years ago
11

1: Which two parts of the taxa do we use to name organisms?

Biology
1 answer:
lorasvet [3.4K]3 years ago
4 0
2.) list and describe each of the three domains
You might be interested in
Child level explanation for what the cell membrane does for the cell
zvonat [6]

it separates the inside of the cell from the environment outside and it controls substances moving in and out of the cell (selectively permeable)

4 0
3 years ago
Consider the following geometric solids a sphere with a ratio of surface area to volume equal to 0.08 M negative one a right cir
azamat

Options:

A. The rate of diffusion would be the same for the two models.

B. The rate of diffusion would be faster for the right cylinder.

C. The rate of diffusion would be slower for the right cylinder.

D. The rate of diffusion would be faster for the sphere.

Answers:

The rate of diffusion would be faster for the right cylinder. Thus, the correct option is B.

To begin with, we must comprehend how the ratio of surface area to volume affects the rate of diffusion.

When comparing the ratio of surface area to volume, a body with a larger surface area will have a higher rate of diffusion than a body with a smaller surface area. It can be expressed mathematically as:

V∝ R    (whereas v is the diffusion rate and r is the surface area to volume ratio)

The answer to the question's surface area to volume ratio for spheres is given 0.8m⁻1

For a right circular cylinder, the surface area to volume ratio is provided  is 2.1 M.

The right circular cylinder has a larger ratio, hence it is obvious that the right circular cylinder will have a higher rate of diffusion because the rate of diffusion is directly related to the surface area to volume ratio.

For more information regarding volume, visit:

brainly.com/question/463363

#SPJ1

4 0
2 years ago
What process takes place in the structure ??
Vitek1552 [10]
<span>cellular respiration 
Hope it helps</span>
3 0
3 years ago
Read 2 more answers
Which of the following is the source of energy for photosynthesis?
natali 33 [55]
The sun is the source for photosynthesis
8 0
4 years ago
Read 2 more answers
Two chronic medical conditions that dialysis patients frequently have in addition to kidney failure are
sergiy2304 [10]
<span>Dialysis patients are prone to a myriad of medical anomalies. The most common medical conditions that dialysis patients have in addition to kidney failure are hypertension and diabetes. Hypertension is the onset of high blood pressure, and diabetes is a disease that prevents the pancreas from regulating glucose levels in the body.</span>
3 0
3 years ago
Other questions:
  • Match each statement below to the correct scientist.
    13·1 answer
  • Which statements are true regarding blood pressure in older adults? Select all that apply?
    13·1 answer
  • A snapdragon with pink flowers with the genotype Rr is mated with a snapdragon with red flowers with the genotype RR. What is th
    7·2 answers
  • Endurance athletes who exercise for long periods of time and consume only water may experience a sodium deficit in their extrace
    10·1 answer
  • Which of the following changes is most likely to happen if the process
    12·1 answer
  • What is taken
    12·1 answer
  • For IPC.
    13·1 answer
  • What skill is a scientist using when she listens to the sounds that an elephant makes?
    6·1 answer
  • What are 4 characteristics of populations? Explain each
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!