1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stellarik [79]
3 years ago
11

Helpppppppppppppppppppppp

Biology
2 answers:
lbvjy [14]3 years ago
8 0
Glucose!
when plants go through photosynthesis, they create a sugar to sustain (feed) themselves, called glucose.
Alexus [3.1K]3 years ago
4 0

Answer:

o Glucose, which required light, water and carbon dioxide to form this substance

You might be interested in
You are required to make a solution of Binding Protein A (BPA) half saturated with its binding partner ligand A. The Kd of ligan
geniusboy [140]
You are given the molarity of the solution which is 1x10-5 M. Since molarity is moles of solute over liters solution. You could determines the moles.

M=m/V
1x10-5 = m/(2 L)
m = 2x10-5 moles ligand A

We could determine the mass of ligand A by using the molar weight:

2x10-5 mol * 250 g/mol = 0.005 grams of ligand A

I hope I was able to answer your question. Have a good day.
5 0
3 years ago
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
adulthood, according to Robins et al. (2001), students show _____ in neuroticism from freshman to senior years in college
AfilCa [17]

Answer:

Decrease

Explanation:

Neuroticism also known as emotional stability is the ability a person has to remain stable. This carachteristic is proven to decrease due to stress during college years.

I hope you find this information useful and interesting! Good luck!

8 0
3 years ago
how can it be possible that you can inhale the same oxygen atom that a dinosaur inhaled 64 million years ago?
Margaret [11]

Answer:

Evolved

Explanation:

The oxygen changed

4 0
3 years ago
The umbra of the Earth's shadow always points:
vivado [14]

C.Directly away from the Sun.

Explanation:

The umbra of Earth’s shadow is about 1.4 million km (860,000 mi) long and points directly away from the sun. A giant screen placed in the shadow at the average distance of the moon would reveal a dark umbra about 9000 km (5700 mi) in diameter, and the faint outer edges of the penumbra would mark a circle about 16,000 km (10,000 mi) in diameter. For comparison, the moon’s diameter is only 3476 km (2160 mi). Consequently, when the moon’s orbit carries it through the umbra, it has plenty of room to become completely immersed in shadow.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Why are biologists concerned about ecosystem disruption? (EXTRA POINTS)
    5·1 answer
  • What are some possible scenarios that could lead to the extincion of a group of organisms?
    7·1 answer
  • What are the causes of chemical weathering ?
    8·2 answers
  • What is the most common toad of Central America.
    8·1 answer
  • Which is an example of a substitution mutation?
    15·2 answers
  • The number of rhinoceroses has decreased to near extinction. How are rhinoceroses classified under the Endangered Species Act
    13·1 answer
  • How are organisms different from one another?
    11·1 answer
  • You are in California playing around in a stream when you come across a substance that appears to be gold. Which test
    9·1 answer
  • Why is phenomenon crossing over important?
    10·1 answer
  • How are amphibians different from reptiles?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!