1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vredina [299]
3 years ago
9

In dna, one nucleotide monomer is linked to the next through _____. ( module 10.2)

Biology
1 answer:
Sergio [31]3 years ago
4 0
In DNA Nucletide monomer are linked to the next through covalent bonds


Hope this helps!
You might be interested in
Cell differentiation defnition
Nonamiya [84]

Answer:

Cellular differentiation is the process in which a cell changes from one cell type to another. Usually, the cell changes to a more specialized type. Differentiation occurs numerous times during the development of a multicellular organism as it changes from a simple zygote to a complex system of tissues and cell types.

7 0
3 years ago
Plants can make their own food through photosynthesis and then break it down for usable energy through the process of cellular r
Ede4ka [16]
Less physical waste, cleaner energy, less environmental effects, list goes on.
<span />
6 0
3 years ago
Read 2 more answers
The diagram illustrates one method of genetic recombination which method of genetic recombination is illustrated in the diagram
photoshop1234 [79]
<span>independent assortment Good Luck</span>
4 0
3 years ago
Why is a diet rich in protein very important to teens?
Naddika [18.5K]
Protein builds muscle.
So it's gonna be the last one.
6 0
3 years ago
Read 2 more answers
The density of a particular small rubber ball is 1.1 g/cm3. It was dropped into a 100 mL beaker filled with 50 mL each of ethano
Pavel [41]

Answer:

A. It sank below the ethanol and distilled water.

Explanation:

6 0
3 years ago
Other questions:
  • Mitochondrial DNA is used to follow maternal inheritance and sequences on the Y chromosome is used to follow paternal inheritanc
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Soft-shell crab is a prized dish in many ocean-side resorts. Why are the crabs' shells soft? Soft-shell crab is a prized dish in
    11·1 answer
  • PLEASE HELP MEH WILL GIVE ALOT OF POINTSSSS
    5·2 answers
  • During what stage of photosynthesis is o2 produced
    10·1 answer
  • Which of the following is an example of the endocrine system directly interacting with the nervous system?
    14·1 answer
  • Males of different species of the fruit fly Drosophila that live in the same parts of the Hawaiian Islands have different elabor
    15·1 answer
  • What is the chemical reaction mechanism by which cells make polymers from monomers?
    15·1 answer
  • Temperature phages
    7·1 answer
  • In your own words, what is the definition for Prokaryotic (include an example)?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!