1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
2 years ago
12

CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION THANK YOU!!

Biology
1 answer:
Kobotan [32]2 years ago
6 0
The answer is B because it multiplies
You might be interested in
Caffeine is also a what?<br> A. Opioid<br> B. Narcotic<br> C. Barbiturate<br> D. Psychoactive
Nady [450]
The answer to this question is D: Psychoactive. It is the world's most widely consumed psychoactive drug.
5 0
3 years ago
Teresa was told by her doctor that her unborn baby has XY chromosomes. What does this
xz_007 [3.2K]

Answer:

The baby is a male. XY = male, XX = female.

Explanation:

Hope this helps.

7 0
2 years ago
Elephants are considered K-strategists because they give birth to only one calf at a time and most have five years in between ha
kicyunya [14]

Answer:

Type I curve

Explanation:

The K-strategist are species characterized by relatively stable populations that fluctuate at the carrying capacity of the habitat or niche in which organisms reside. Elephants are considered as K-strategists because they have a low population growth rate and relatively stable populations. There are three different types of survivorship curves. The Type I curve (also referred to as A curve) is characteristic of k-strategist organisms. Humans and elephants exhibit a Type I survivorship curve in which organisms tend to die when they become elderly. These species have a small number of offspring and provide parental care to ensure their survival. In a Type II survivorship curve, species produce many offspring and only some offspring survive (e.g., birds), while in Type III survivorship curve organisms produce many more offspring and most do not survive (i.e., r-strategists such as frogs or insects).

8 0
3 years ago
Which membrane would show a more rapid recovery of fluorescence in a frap study?
ziro4ka [17]

Answer: a membrane containing a larger proportion of unsaturated fatty acids

Explanation:

4 0
2 years ago
Why is cytoplasm like jelly
Ganezh [65]
it divides organelles so don't they run into each other
5 0
2 years ago
Other questions:
  • In 1953, who developed the model that is shown below?
    8·2 answers
  • Which structure is not part of endomembrane system
    5·2 answers
  • Prior to meiosis during which stage of the cell cycle does dna replication occur
    14·1 answer
  • Why is it hard to build shelter on mars ?
    14·2 answers
  • What is the most common type of lab accident?
    9·2 answers
  • What are the three types of counseling established by marine corps policy?
    13·1 answer
  • If you bruised your gluteus maximus, you would expect to experience discomfort when
    7·2 answers
  • Can someone please help with this assignment?
    8·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Earth’s mantle plays an important role in plate tectonics. Why is the mantle so important to this process?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!