1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Simora [160]
3 years ago
5

Draw a Conclusion

Biology
1 answer:
Nonamiya [84]3 years ago
8 0

Answer:

The Jacky dragon may not survive.

You might be interested in
Which statement is correct concerning the cell walls?
k0ka [10]

Answer:

All plants remain rigid because of cell walls.

Explanation:

4 0
3 years ago
Here's another dinosaur skull--the allosaurus. Does
UkoKoshka [18]
To me a scaly lizard because many furry dinosaurs were herbivores and that skull dint have the teeth of an herbivore.
7 0
3 years ago
If the lead in DNA nitrogen bases on one side of the DNA chain are TATGCGCCCTT what were the opposite side of the ladder of DNA
DanielleElmas [232]

Answer:

ATCGCGGGAA

Explanation:

The way I learned this was with the word "GCAT". G pairs with C and vise-versa and A pairs with T and vise-versa. This is how you know what the opposite chain of DNA will look like.

8 0
3 years ago
A student is studying which fertilizer/soil will produce the tallest tomato plants. She will use regular dirt, Miracle Gro, Dr.
Step2247 [10]

Answer:

the answer would be the different soils she is using

3 0
4 years ago
Your body has designed a traffic signal for action potentials traveling from one neuron to another. in this system, a red light
Kipish [7]
A reaction to something that has happened and affected the body as it was trying to prevent the action

3 0
4 years ago
Other questions:
  • What is the role of glucose in catabolite repression?
    5·1 answer
  • Which statement describes an invasive species? OA. It is a native species that has no predators. O B. It is a nonnative species
    8·1 answer
  • What structure do grass frogs use to detect sound waves​
    5·2 answers
  • Leona is making lemon pudding from "scratch." Her ingredients include fat-free milk, corn starch, lemon juice, egg yolks, salt,
    8·1 answer
  • An increase in herbivore populations in an ecosystem will soon lead to
    8·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • What we need to do for speed up photosynthesis
    10·2 answers
  • The cuticle _____.
    15·1 answer
  • All of the following are limitations of the biological species concept,
    13·1 answer
  • 7.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!