1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trapecia [35]
3 years ago
14

Which of the following materials is necessary for scientists to estimate the age of the solar system?

Biology
1 answer:
SCORPION-xisa [38]3 years ago
7 0

Answer:

B) meteorite sample

Explanation:

The age of the solar system, derived from the study of meteorites (thought to be the oldest accessible material around) is near 5 billion years; that of the Earth is taken as 4.6 billion years. The oldest rocks on Earth are dated as 3.8 billion years.

You might be interested in
Stars start as… a. Cosmic rays b. Chunks of rock c. Disks of dust and gas d. Ice
Vadim26 [7]
C Disks of Dust and Gas
3 0
3 years ago
Read 2 more answers
The clumping of blood from mismatched blood types is a problem for a patient because
baherus [9]
<span>
The ABO blood group classification is based on antigens on red blood cells and antibodies found in blood plasma.</span>Blood type A has antigen A on the red blood cells and anti - B antibodies in the blood.Blood type B has antigen B on the red blood cells and anti - A antibodies  in the blood.Blood type AB has both antigen A and B on the red blood cells but has no anti-A nor anti - B antibodies in the blood<span>Blood type O has no antigen on the red blood cells and has both anti -A and anti B antibodies in the blood.</span>
8 0
3 years ago
Predict what might happen if the broad ligament and other supporting ligaments were damaged by infection or injury
Solnce55 [7]

If<span> the broad ligament and other supporting ligaments were damaged by infection or injury, this incident may cause to permanent damage or worse even death. This can even lead to infertility because broad ligament is the tissue that stabilizes the uterus, liver and diaphragm.</span> 

3 0
3 years ago
Description of esophagus
BartSMP [9]
1. Treatable by a medical professional
2. Requires a medical diagnosis
<span>3. Lab tests or imaging always required

Thank You, 
 Helpingothers


</span>
5 0
3 years ago
The cartilage on the ends of wendell's joints is deteriorating. around age 65, he developed bony lumps on the end of the joints
vivado [14]
Arthritis is a joint disorder involving joint inflammation.Pain is often localized to only the affected joint. Osteoarthritis is a wear and tear type of arthritis often affects aging population affecting joints in hands,knees and lower back. Heberden's node is an example and develops around middle age thus Wendell might have this.
8 0
3 years ago
Other questions:
  • What are the main sources of fresh water used by humans
    5·2 answers
  • Which determines what an organism looks like and how it grows and develops?
    12·2 answers
  • Explain how scientists manipulate dna
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why does water resist temperature change
    11·1 answer
  • A portion of one DNA strand of the human gene responsible for cystic fibrosis is 5' ......ATAGCAGAGCACCATTCTG.....3' Write the s
    7·1 answer
  • Using the following cladogram, put the following organisms in order from most evolved to
    8·1 answer
  • What is the difference between an infectious disease and a noninfectious disease?
    14·1 answer
  • What exaclty is a mutation?
    14·1 answer
  • The correct way to calculate population size is by dividing the total population by the land area.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!