1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vaselesa [24]
4 years ago
10

If the parents are AABBCC X aabbcc, what would represent the parental gametes? Select all that apply

Biology
1 answer:
olga55 [171]4 years ago
3 0
Take one gene at a time
B.ABC
A. abc
You might be interested in
What happens to the functionality of a protein if the pH changes
d1i1m1o1n [39]
Changes in pH change the attractions between the groups in the side chains of the protein.
5 0
3 years ago
Which characteristics are always present in all living organisms? -Movement -Heredity -Reproduction -Homeostasis -Sensitivity -M
Maslowich
Characteristics that are always present in living organisms are _____. Answer. Living organisms are feeding, moving, breathing, excreting, growing, reproducing, and are sensitive.
7 0
3 years ago
You push an object really hard but it does not move. Has “work” been done?
kobusy [5.1K]

Answer:

No

Explanation:

Work is when motion is accomplished

5 0
2 years ago
Read 2 more answers
What quantity caan tell you whether a solution is acidic or basic
astra-53 [7]
I believe you use the pH scale with comparing acids and bases.
5 0
4 years ago
Pls, I need help with this! Biology Thank you :)
topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0
3 years ago
Other questions:
  • Dna is located in a non membrane bound region in a prokaryotic cell called the
    7·1 answer
  • What is the name given to blood clot within an artery? what is the answer?
    12·1 answer
  • Question 1
    15·2 answers
  • What plant organelle performs photosynthesis
    6·2 answers
  • It is the role of the ____ to receive and send electrical messages throughout the body?
    6·2 answers
  • What's the Arabian Gulf's salinity?
    7·1 answer
  • Production of excessive amounts of acetyl coa molecules leads to the synthesis of ____.
    15·1 answer
  • an organisim has 34 chromosomes in each of it's cells. how many chromosomes would it have in a sex cell
    8·1 answer
  • Identify the example below that is NOT considered an evidence of evolution.
    15·1 answer
  • The _____ stage lasts approximately _____ week(s), beginning at conception.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!