1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slamgirl [31]
3 years ago
9

In which state is a plant cell healthiest ?

Biology
1 answer:
Alex17521 [72]3 years ago
8 0

Answer:

Hypotonic

Explanation:

At this point, the cell is turgid (very firm), the healthy state for most plant cells. Plants that are not woody, such as most houseplants, depend for mechanical support on cells kept turgid by a surrounding hypotonic solution

You might be interested in
How might the carrying capacity of a coastal ecosystem change as the result of a tsunami? Explain using one or more examples
vlabodo [156]

Answer:

A tsunami <u>reduces the carrying capacity</u> of the coastal environment.

It damages the ecosystem by reducing the available resources such as food or shelter, and consequently decreases the number of individuals.

Explanation:  

Due to technical problems, you will find the complete answer and explanation to this question, in the attached files.

Download pdf
7 0
3 years ago
Greatest diffrence between cells of a baby gorilla and the cells of an adult gorilla
Trava [24]

Answer:

That the adult has more cells than the baby?

Explanation:

Cells are the basic unit of structure and function in all living organisms. Which describes the GREATEST difference between the cells of a baby gorilla and the cells of an adult gorilla? The adult has more cells than the baby.

Sorry if its wrong

5 0
3 years ago
Reactions between atoms occur when:
VikaD [51]

Answer; All the above

A) an atom seeks to fill its outer shell of electrons

B) an atom seeks to balance its positive and negative charges

C) the reaction will result in paired electrons

Explanation;

-In a chemical reaction, reactants contact each other, bonds between atoms in the reactants are broken, and atoms rearrange and form new bonds to make the products.

-During a chemical reaction an atom may lose of gain electrons resulting positive and negative ions (ionic bond formation) or may result to the paired electrons (sharing of electrons).

5 0
3 years ago
Read 2 more answers
Which of the following is an example of non Mendelian pattern of inheritance
diamong [38]

Answer:

<h3>Genomic imprinting represents yet another example of non-Mendelian inheritance. Just as in conventional inheritance, genes for a given trait are passed down to progeny from both parents. However, these genes are epigenetically marked before transmission, altering their levels of expression.</h3>

6 0
2 years ago
Read 2 more answers
Which of these insects goes through incomplete metamorphosis?
RUDIKE [14]
The answer is ant its d

7 0
3 years ago
Read 2 more answers
Other questions:
  • Q4.10. Marathon runners can lose a great deal of Na* (through sweat). Some runners
    15·1 answer
  • A client has been prescribed risperidone for autism spectrum disorder. what should the nurse instruct the care provider about ad
    14·2 answers
  • Through , larger molecules are formed
    9·1 answer
  • Molecules of ATP are produced during the light-dependent reactions of photosynthesis and then transferred to the light-independe
    6·1 answer
  • This type of macromolecule stores and transmits genetic information
    12·1 answer
  • What is the main primary producer in a coral reef ecosystem?
    9·2 answers
  • The scientific name for a white oak is Quercia Alba; the scientific name for a red oak is Quercia Ribera what does this tell you
    12·1 answer
  • What is a medulla? what do forensic scientists use this for?
    12·2 answers
  • Which branch of science was newly developed after the discoveries about DNA?
    7·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!