1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
3 years ago
13

How do sulfur and phosphorus move from the biotic to the abiotic pools during their cycles? A) Primary consumers eat producers.

B) Secondary consumers eat primary consumers. C) Plant material is deposited in layers of ponds and lakes. D) Decomposers break down the remains of producers and consumers.
Biology
1 answer:
worty [1.4K]3 years ago
4 0

Answer:D) Decomposers break down the remains of producers and consumers

Explanation:A biotic pool is a tidal pool with diverse and changing habitats of living factors. We can say they are important mini ecosystems within the larger ecosystem.

The abiotic pool involves the elemental phases of nature,the non living parts of the ecosystem. Decomposition (break down) of elements/organic compounds is the characteristic bridge between both pools into what is known as nutrients.

This tell us that the ultimate dead part of producers and consumers are used up in this process.

Some of the nutrients released in the biogeochemical cyclic process includes sulfur and phosphorus and they move through the ecosystem.

Note: The biogeochemical cycle is a pathway of movement for chemical elements.

The chemical elements in nature moves through both biotic and abiotic components via abiotic and biotic interaction in the ecosystem

Few abiotic factors includes rocks, air, water, and chemicals while biotic factors includes living organisms activities.

All living and non living elements of nature play vital roles in the great biogeochemical cycle.

You might be interested in
Where is ATP made in the chloroplast? What other activated carrier is produced in the space?
miskamm [114]

Answer:

The correct answer will be -

1. ATP production- Thylakoid membrane

2. Activated carrier- NADPH.

Explanation:

The photosynthesis reactions take place in the chloroplast which is divided into three membranes: outer, inner and thylakoid membrane. The light-dependent reactions take place in the thylakoid membrane which helps in the production of ATP molecules along with the activated carrier molecule called NADPH.  

The ATP molecule is synthesized by the ATP synthase enzyme located in the thylakoid membrane where electron transport chain produces a gradient of protons. These protons help in the production of ATP synthesis explained through the chemi-osmotic model.

Thus, the Thylakoid membrane and the NADPH are the correct answer.

5 0
3 years ago
Explain how cells specialize to form specific tissue and organs?
S_A_V [24]
<span>All cells have the same DNA. They are different because different genes have been locked up and only some of them are expressed. The process began in the embryonic stage, when stem cells are turned into different types of cells by turning off some of the genes. Scientists have been looking for ways to reverse the process, meaning turning specialized cells back into stem cells. Some success has been reported using different methods. The latest one uses a weak acid to stress the cells.</span>
5 0
3 years ago
Use Figure 1 to evaluate each trigonometric function of angle A . The side adjacent to angle A has length 8 and the side opposit
jonny [76]

The trigonometric ratios are;

  • Sin A = 0.78
  • Cos A = 0.625
  • Tan A =  1.25
<h3>What are the trigonometric ratio?</h3>

The trigonometric ratios are sine, cosine and tangent. Now we have the hypotenuse of the triangle. Figure 1 has been shown in the image attached to this answer.

c = √8^2 + 10^2

c = 12.8

sin A = 10/12.8 = 0.78

Cos A = 8/12.8 = 0.625

Tan A = 10/8  = 1.25

Learn more about the trigonometric ratios:brainly.com/question/13724581

#SPJ1

7 0
2 years ago
Which quality makes Earth particularly well-suited to support life?
Vaselesa [24]
I would say D narrow temperature. Most other planets are too hot or cold to sustain life.
3 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Which land ecosystem depends on a good root system?
    14·2 answers
  • If a single bacteriophage infects one E. coli cell present on a lawn of bacteria and, upon lysis, yields 175 viable viruses, how
    10·1 answer
  • John drank six 12-ounce beers from 9 p.m. to 12 a.m. How many drinks still remain in his bloodstream?
    7·1 answer
  • Excretion of dilute urine requires ________. A. the presence of ADH B. transport of sodium and chloride ions out of the descendi
    12·1 answer
  • What is an ion? what is an ion ?
    8·1 answer
  • Which of the following is NOT a difference between RNA and DNA molecules? *
    14·1 answer
  • HELP ASAPPP Why can insertions and deletions affect more than just the codon(s) that they directly change? Hint: Why are they ca
    13·1 answer
  • Please help
    14·1 answer
  • NEED HELP ASAP WILL MARK BRAINLIEST!!
    10·2 answers
  • The latitude at which the noon sun is directly overhead is known as the sun’s:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!