1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
3 years ago
8

A certain type of frog reproduces sexually and has 36 pairs of chromosomes in each of its body cells. How many chromosomes are i

n each of the frog’s sex cells?
9
18
36
72
Biology
2 answers:
uranmaximum [27]3 years ago
7 0

Answer:

c-36

Explanation:

36 chromosomes are in each of the frog’s sex cells

Fudgin [204]3 years ago
6 0

Answer:

36

Explanation:

on edge2020

You might be interested in
Ice wedging is a form of chemical weathering. t/f
larisa [96]
Ice wedging is a form of mechanical weathering not chemical weathering.

False
8 0
4 years ago
Read 2 more answers
Question 1 (5 points)
Alik [6]

Answer:

n is an even number if and only if it's divisible by 2.

Explanation:

Biconditional statement is a type of statement which is only written when the both segments of the sentence are true. For writing biconditional statement, ''if and only if'' words should be used. For example, the two sides of the triangle are same if and only if both have same length. The biconditional statement considered as true if both the segments are true in nature. Symbolically, it is denoted by double arrows between two symbols.

5 0
3 years ago
Growing up, Darwin saw that farm animals with preferred traits were choosen for breeding those chosen animals usually produced o
SpyIntel [72]
Selective breeding is the answer

7 0
3 years ago
An experiment was set up to test the effects of different carbohydrates on fermentation of yeast. According to the experimental
forsale [732]

Answer:

The correct answer is D) Rate of fermentation.

Explanation:

Carbohydrates are fermented by yeast to form alcohol by alcoholic fermentation.

       Now if the effects of different carbohydrate molecules are tested on yeast then the yeast will ferment different sugar molecules at different rate.

       As a result the rate of fermentation will be the independent variable of the experiment.

7 0
3 years ago
Read 2 more answers
How are mutations passed to offspring?​
nlexa [21]

Answer:

The only mutations that matter to large-scale evolution are those that can be passed on to offspring . These occur in reproductive cells like eggs and sperm and are called germ line mutations . A single germ line mutation can have a range of effects : No change occurs in phenotype.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Water lilies have large flat leaves covering the surface of the water, why do you find few plants growing underneath them?
    15·1 answer
  • What’s the answer to this?
    11·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • In the nature-nurture issue, nature refers to an organism's _____, nurture to its _____.
    10·2 answers
  • List four ways prokaryote cells may vary.
    8·1 answer
  • Why doesn’t every meteor become a meteorite?
    15·1 answer
  • A student attaches a rope to the handle of a chest loaded with few books , books while the other end of the rope is tied to a sc
    5·1 answer
  • What process is used to form polymers from monomers
    11·1 answer
  • What do you think would happen if negative feedback mechanism absent in our body?<br>​
    8·1 answer
  • If a molecule of DNA is 22% guanine, what is the approximate percentage of thymine?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!