1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rewona [7]
3 years ago
13

What does the Earth rotate around? Explain

Biology
2 answers:
emmasim [6.3K]3 years ago
5 0
The earth rotates around its axis as it revolves around the sun. it takes the earth one year to complete a revolution.
icang [17]3 years ago
5 0

Answer:

So the Earth rotates around its axis as it revolves around the sun. It takes the Earth 365 days, or one year, to complete a revolution. Leftover momentum from when planets were forming makes the Earth, and all planets in the solar system, rotate and revolve.

Explanation:

You might be interested in
The adjustable opening in the center of the eye that helps control the amount of light entering the eye is called the __________
goldfiish [28.3K]
Pupil is the answer, it changes according to the light it recives
6 0
3 years ago
Read 2 more answers
Compare Rutherford’s model of the atom with Bohr’s model.
timurjin [86]

How was Bohr's atomic model similar to Rutherford's model?

it described a nucleus surrounded by a large volume of space.

3 0
3 years ago
Give any two examples for gas pressure​
skelet666 [1.2K]

Answer:

tire and balloons

Explanation:

the tire of an car contains gas pressure

the balloon also contains gas pressure because it contains gas molecules

7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Is the talc renewable?
Alekssandra [29.7K]

Answer:

no.its nonrenewable.

talc is nonrenewable.

thanks.

7 0
3 years ago
Other questions:
  • What are 5 characteristics of the atmosphere
    13·1 answer
  • Order of EMBIOPTERA​
    12·1 answer
  • What is the allele frequency?
    11·2 answers
  • What membrane protein identifies the cell to the immune system?
    10·1 answer
  • Do only cars produce Carbon dioxide? True or False? (Explain why?)
    12·1 answer
  • Which part of cellular respiration must occur before any of the other steps can occur
    14·2 answers
  • Which of the following accurately describes a characteristic of fungi? 
    6·1 answer
  • What is Alzheimer’s Disease and how is it caused from the chromosomes?​
    5·1 answer
  • Which of the following statements is true about the glycocalyx? Check All That Apply
    11·1 answer
  • Which mechanism contributes to the long-term enhancement of the gill withdrawal reflex in Aplysia but is not involved in the sho
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!