1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
daser333 [38]
3 years ago
11

If an organism's cells are reproducing, then the organism must be A.growing.B.reproducing.C.alive.D.all of these

Biology
2 answers:
Gala2k [10]3 years ago
8 0

Answer: D

Explanation: growth, and life all are required for reproduction

nevsk [136]3 years ago
6 0

Answer:

the anwser is d all of these

Explanation:

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Based on the cladogram, which of these organisms are the most closely related?
Drupady [299]
According to the cladogram, arthropods are MOST closely related to which group of organisms? mollusks. annelids. echinoderms.
7 0
3 years ago
What did Mendel call the first two individuals that mate in a genetic cross?
Cloud [144]

The correct answer is C!

6 0
3 years ago
Read 2 more answers
Which disorder, diagnosed in the 1800s, was believed to be caused by a woman experiencing "wandering movements of the womb"?
HACTEHA [7]
A 2nd-century hysteria was caused by the belief that the uterus could move freely within the body in search of fluid and cause specific symptoms depending on the areas the uterus was displaced to. Called the wandering womb disorder, the womb was believed to be a living thing within a living thing.
6 0
3 years ago
Conteste los siguientes enunciados, registrando (F) si es falso y (V) si es verdadero. 1. ( ) Una mujer portadora de hemofilia,
Ksenya-84 [330]

Answer:

1. Verdadero

2. Falso

3. Falso  

4. Falso

5. Verdadero

Explanation:

Los seres humanos, como así también la mayoría de los mamíferos, poseen dos cromosomas sexuales: un cromosoma X y un cromosoma Y. Las hembras poseen 2 cromosomas X (un cromosoma X es heredado de la madre y el otro cromosoma X es heredado del padre); mientras que los hombres tienen un cromosoma X y un cromosoma Y (el cromosoma X es heredado de la madre, mientras que el cromosoma Y es heredado del padre). La hemofilia es una enfermedad recesiva monogénica ligada al cromosoma X, la cual está caracterizada por cuadros hemorrágicos causados por el déficit parcial y/o total de factores de coagulación. Los hombres expresan el fenotipo recesivo con mayor frecuencia que las mujeres para aquellos genes que se encuentran en el cromosoma X y poseen un mecanismo de herencia recesivo, esto debido a que los hombres sólo poseen una copia del alelo ligado al X (lo que hace que el alelo recesivo se exprese con mayor frecuencia en el fenotipo). De este modo, los hombres manifiestan hemofilia con mayor frecuencia que las mujeres porque en mujeres el gen recesivo necesita la presencia de dos copias del alelo defectuoso recesivo para que se exprese en el fenotipo hemofílico (es decir, las mujeres heterocigotas son portadoras de un alelo defectuoso pero no expresan la condición en el fenotipo), mientras que en los hombres la presencia de un sólo alelo defectuoso localizado en su único cromosoma X es suficiente para la expresión del fenotipo recesivo. En hombres, los genes ligados al cromosoma X son siempre heredados de la madre (los hombres heredan del padre el cromosoma Y). Finalmente, la herencia de caracteres ligados al cromosoma Y es muy rara porque los genes localizados en la región diferencial del cromosoma Y son escasos y estos genes solamente pueden ser trasmitidos de padres a hijos varones (ya que se encuentran en el cromosoma Y).

6 0
3 years ago
Other questions:
  • Alternative rna splicing ________. can allow the production of similar proteins from different genes is due to the presence or a
    11·1 answer
  • As of 2009, all living human beings have had their entire genome sequenced.
    6·1 answer
  • In ferns the spores develop on
    12·1 answer
  • Process where usable solutes are reclaimed by the body.
    9·1 answer
  • How does an enzyme speed up a chemical reaction? Enzymes:
    9·1 answer
  • For the DNA base sequence GGG what is the mRNA codon? What is the tRNA codon that binds to the mRNA codon and what is the correc
    5·2 answers
  • During a blood drive, Shaun noticed that the nurse punctured his vein to connect the tube for withdrawing blood. Why is blood ob
    14·2 answers
  • Many anti-evolutionists believe that since science doesn't have answers for all questions; scientific conclusions are not necess
    8·1 answer
  • 2. the water on earth came from ancient
    6·2 answers
  • The world population has surpassed 7 billion and is continuing to increase dramatically. Select the factor that has demonstrated
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!