Answer:
The northwest moving Pacific Plate has moved across the 'hot spot' that created the Hawaiian Islands for millions of years. This movement has left the northwest trending island chain
Explanation:
If the Pacific Plate keeps moving across the hot spot I believe Hawaii will keep becoming a bigger island because the Pacific plates movement caused Hawaii to form.
Answer:
A food chain is a representation of what eats what in an ecosystem.
A combination of food chains is termed as a food web.
Example of two food chains in a food web are :
Example No 1:
Plant----- Grasshopper------ Frog---snake--- bacteria
Example No 2:
Plant---- rabbits---- fox---- bacteria
In a food chain, producers are usually plants and algae which are able to make their own food. Consumers feed on the plants. In example no 1, grasshoppers are primary consumers, frogs are secondary consumers, snakes are tertiary consumers.
In example no 2,plants are producers, rabbits are primary consumers and foxed are secondary consumers.
Decomposers are organisms that feed on the dead organisms in a food chain. In both the examples of food chain, bacteria are the decomposers.
Answer:D) Samples A & C indicate cancer due to the large proportion of cells in some stage of mitosis compared to the cells in interphase.
Sample: Number of Cells in Interphase Number of Cells in Prophase Number of Cells in Metaphase Number of Cells in Anaphase Number of Cells in Telophase
Sample A 6 15 4 7 8
Sample B 25 4 2 3 1
Sample C 4 9 5 3 6
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
