1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sladkaya [172]
3 years ago
6

When unstable elements lose particles and become more stable it is called

Biology
1 answer:
Lady bird [3.3K]3 years ago
8 0

Answer:

ions?

Explanation:

If it picks up or loses an electron, it becomes electrically charged and highly reactive. Such electrically charged atoms are known as ions. ... In an effort to achieve equilibrium, the atom emits particles in the form of radiation until the nucleus is stable. Such unstable atoms are said to be radioactive.

You might be interested in
Describe and name 2 types of Mechanical weathering
Studentka2010 [4]
Frost wedging - water expands about 9% after freezing this pushes against the rock and fractures or breaks it open.

thermal expansion - <span>is the tendency of matter to change in shape, area, and volume in response to a change in temperature.</span>

6 0
4 years ago
Which structure is unique to eukaryotic cells?
Mrrafil [7]

Answer:

Membrane-Bound Organelles

6 0
4 years ago
A toad is brought into a new ecosystem. It is stronger than the toads that already live there and reproduces quickly. Which is t
serg [7]

Answer:

Invasive

Explanation:

it is invasive

3 0
3 years ago
Read 2 more answers
 please answer quick and correctly
lisabon 2012 [21]

Answer:

Yes, you are right for both.

7 0
3 years ago
Recall that photosynthesis consists of two sets of chemical reactions. Which of these describes the energy conversions that occu
belka [17]

Chemical energy chemical energy

8 0
4 years ago
Read 2 more answers
Other questions:
  • What are the ways in which matter and<br> energy can interact?
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which observation could be used to determine that an organism is an autotroph?
    10·2 answers
  • Helppp !! 1. Describe the structure of an atom and how to read an element box using at least
    12·1 answer
  • Information of vertebrates mammal​
    6·1 answer
  • Which of the following provides a way for plants to multiply themselves using cloned offsets?
    9·1 answer
  • PLZZZZZ HELPPPPPPP!!!!
    14·2 answers
  • A substrate is a substance that is affected by
    10·1 answer
  • Which scientists was the first to discover that plants gain their mass from water?
    7·1 answer
  • I need help with dis plz
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!