1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
14

4. The diagram below represents one possible immune response that can occur in the human body.

Biology
1 answer:
krek1111 [17]3 years ago
8 0

Answer:

A and C only

Explanation:

I'm sorry I don't know how to explain it but trust me its A and C only.

You might be interested in
Before United States citizens travel to Africa, a(n) _____ for yellow fever is required.
saw5 [17]

Answer:

Vaccine

Explanation:

I'm not sure but it seems like the most logical answer.

8 0
3 years ago
Read 2 more answers
Recalling the Role of Genes Segments of __ transferred from parent to offspring are called genes.
denpristay [2]
DNA would be your answer.
7 0
3 years ago
Single strands of nucleic acids are directional, meaning that there are two different ends. What functional groups define the tw
pickupchik [31]

Answer:

The functional groups that define the two different ends of a single strand of nucleic acids are:

B. a free hydroxyl group on the 5' carbon a free hydroxyl group on the 3' carbon

G. a free phosphate group on the 5' carbon

Explanation:

A nucleic acid is a polymer formed of nucleotides that are linked with a phosphodiester bond. The structure of a nucleotide consists on a phosphate group linked to a pentose (ribose in RNA and deoxyribose in DNA) that is also attached to a nitrogenous base. The nitrogenous bases are adenine, guanine, cytosine, thymine (in DNA) and uracil (in RNA).

DNA and RNA are nucleic acids which can be found in a double or single strand presentation.

Nucleic acids are synthesize in the 5’ to 3’ direction, so that is why the convention is that the sequences are written and read in that direction.

The strand of a nucleic acid is directional with an end-to-end orientation, where the 5’ end has a free hydroxyl or phosphate group on the 5' carbon of the terminal pentose, and the 3’ end has a free hydroxyl group on the 3’ carbon on the terminal pentose (ribose/ deoxyribose).

3 0
3 years ago
Endocarditis occurs when bacteria infect the bloodstream and attach themselves to the inner lining of the heart or a defective h
Allisa [31]

Answer:

Streptococcal or Staphylococcal bacteria

Explanation:

They attach themselves to the inner lining of the heart making it to becme inflamed and casing damage to the heart valves.

3 0
4 years ago
If trypsin were to be placed in an acidic environment, how would it function? How do you know?
Nina [5.8K]

Answer:

If trypsin is in an acidic environment, it will decrease its function, since its optimum pH is 8.

Explanation:

Trypsin is an enzyme responsible for break peptide bonds, thus hydrolyzing proteins into peptides and amino acids. This enzyme is secreted by the pancreas and poured into the duodenum —an alkaline environment— where it acts.

<u>Since the </u><u>optimal pH for trypsin to fulfill its function is 8</u><u>, if the enzyme were placed in an </u><u>acidic environment</u><u> it would decrease its function</u>. This is because enzymes work under specific pH and temperature conditions, and changes in these conditions affect enzymatic activity.

7 0
3 years ago
Other questions:
  • Sally's teacher asked her to classify the organisms in a sample of pond water. One KEY feature can be seen that helped Sally rul
    7·2 answers
  • What are the roles of the parasympathetic nervous system and sympathetic nervous system in maintaining everyday homeostasis?
    6·1 answer
  • Two mutant flies both have white eyes (red is the normal eye color) but were each isolated in different labs and therefore have
    10·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which of the following reflects Malthus's view of population growth?
    10·1 answer
  • Which type of reproduction is when two cells come together to produce a new individual?
    5·2 answers
  • Describe the similarities and differences between cellular respiration and fermentation.
    8·1 answer
  • Cellular respiration takes place in the presence of and with the use of which of the following
    7·1 answer
  • गृहकार्य वर्तमान काल, भूतकाल र भविष्य कालको ५ ५ वटा वाक्य बनाउनुहोस​
    13·1 answer
  • And your Answer is Best management practices (BMPs) are methods that have been determined to be the most effective and practical
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!