1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tcecarenko [31]
3 years ago
8

Antennae development in ants is thought to be a trait controlled by maternal effect. In ants, zig-zag coils are dominant to curl

y coils. Assume that a female develops zig-zag coils. What can be determined about inheritance of this trait in her family?
a. Her mother has zig-zag antennae.
b. Her brother has zig-zag antennae.
c. This female carries the zig-zag allele
d. This female's offspring will have zig-zag antennae.
Biology
1 answer:
Schach [20]3 years ago
3 0

Answer:

a. Her mother has zig-zag antennae.

b. Her brother has zig-zag antennae.

Explanation:

<u>Available data</u>:

  • Antennae development ⇒ controlled by maternal effect
  • Zig-zag coils are dominant
  • Curly coils are recessive
  • A female develops zig-zag coils

Maternal effect: Refers to the influence of the “environment provided by the mother” on the progeny phenotype. The mother´s genotype directly determines the progeny phenotype. Even though the progeny has a different genotype, it is irrelevant, as well as the father´s genotype or phenotype. This means that no matter what is the genotype of the offspring, all of them will express the same phenotype as their mother. The maternal effect is commonly seen in insects and might be seen in some mammals and plants.

So, if a female has zig-zag coils, this means that the mother also has zig-zag antennae and that all the brothers and sisters of this female ant have zig-zag antennae, independently of their genotype.

a. Her mother has zig-zag antennae ⇒ True. The trait is inherited from the mother.  

b. Her brother has zig-zag antennae ⇒ True. The whole progeny will express sig-zag antennae.

c. This female carries the zig-zag allele ⇒ Not necessarily.

d. This female's offspring will have zig-zag antennae ⇒ Depends on it´s genotype

You might be interested in
Which macromineral plays a role in energy production through its role in the breakdown of all three energy sources (carbohydrate
umka21 [38]
Phosphorus because it is an energy source and breaks down carbs proteins and. Fats
7 0
3 years ago
Read 2 more answers
An ecosystem can be best defined as which of the following? a. all of the interactions between physical processes and the abioti
Travka [436]
I believe it’s c. Hope it helps :)
8 0
3 years ago
Read 2 more answers
Which of the following is NOT true about “yield”? a. the value of the actual yield must be given in order for the percent yield
Law Incorporation [45]
The right answer for the question that is being asked and shown above is that: "b. the act<span>ual yield may be different from the theoretical yield because reactions do no always go to completion." This is the statement that is not true about "yield."
</span>
8 0
3 years ago
PH scale *
kondor19780726 [428]

Answer:

d

Explanation:

measures hydrogen ion concentration

The pH of a solution is a measure of the concentration of hydrogen ions in the solution. A solution with a high number of hydrogen ions is acidic and has a low pH value. A solution with a high number of hydroxide ions is basic and has a high pH value. The pH scale ranges from 0 to 14, with a pH of 7 being neutral.

5 0
3 years ago
Which bones make up the elbow joint? 
Nataly [62]
The elbow is made up of the humerus, radius and ulna so your answer is A
7 0
3 years ago
Other questions:
  • How are light microscopes different from electron microscopes?
    6·1 answer
  • In tomatoes, two alleles of onegene determines whether the plant has purple (P) or green (G) stems, and a separate, independent
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following organisms groups was originally considered an animal by zoologists
    13·1 answer
  • A cell with a single set of chromosomes is called a
    15·1 answer
  • Why is water extremely cohesive?
    11·1 answer
  • What does gymnosperm mean in latin
    13·2 answers
  • You are a molecule of carbon. Choose a starting
    5·1 answer
  • 20 PTS please help! Why is cell differentiation important in the growth and development of human beings?
    13·2 answers
  • a plant cell has a specific organelle which is basically can not be found in an animal cell. reflect on the function of each. wh
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!