1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
2 years ago
5

Which adaptation allows reptiles to live entirely on land check all that apply

Biology
2 answers:
allochka39001 [22]2 years ago
3 0
Living on land means reptiles can't rely on absorbing oxygen through their skin like amphibians. All reptiles have lungs they use for breathing -- even those who live most of their lives near or in water, such as crocodiles, must surface to breathe. Lungs allow reptiles to venture far away from aquatic environments.
motikmotik2 years ago
3 0

Answer:

Sample Response: Reptiles have dry, tough skin covered in scales, which reduces water loss. Reptiles breathe using lungs; they do not exchange gases through their skin. Their kidneys also help prevent water loss by concentrating their urine. Young reptiles develop inside an amniotic egg, which is covered with membranes and a shell to prevent it from drying out.

Explanation:ye

You might be interested in
Cytokinesis in animal cells differs from mitosis in plant cells in that animal cells do not form _[blank]_. a contractile belt c
V125BC [204]

Their main difference is how they form the daughter cells during cytokinesis. During that stage, animal cells form furrow or cleavage that gives way to formation of daughter cells. Due to the existence of the rigid cell wall, plant cells don't form furrows.

Hope this helps, if not let me know. Also, do you have multiple choice answers? If this isn't one let me know the options and I'm sure I can help.

8 0
3 years ago
Read 2 more answers
A mutation may cause a change in the genotype of a trait? <br><br> True or false
AnnyKZ [126]

Answer:

true

Explanation:

mutations deal with chromosomal changes, and while they might not always be reflected in the phenotype.. the genotype does change

6 0
3 years ago
The energy role of a grizzly bear is that of a --- because it can not make it's own food
lesya [120]
The energy role of a grizzly is that is is a omnivorous consumer because it is not a producer.

A grizzly bear's diet consist of both plants and animals as it relies on the food it eats for energy consuptions. It is incapable of producing energy with photosythesis, hence it is not a producer.
3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Which of the following is carried out in the Golgi apparatus of the cell? (4 points)
Romashka [77]

Answer:

Protein modification and storage

7 0
3 years ago
Other questions:
  • Every november, tens of thousands of sally lightfoot crabs on christmas island leave their rain forest habitats at the same time
    12·2 answers
  • NEED IMMEDIATE HELP!! WILL GIVE BRAINLIEST!!!
    14·1 answer
  • What is photosynthesis ​
    7·1 answer
  • One of the ways that acid rain is harmful is _____.
    5·2 answers
  • Alimentos mexicanos de alto valor nutrimental
    11·1 answer
  • If someone asked you how wide your desk is, how would you measure it? Would you measure using inches, centimeters, feet, yards,
    7·1 answer
  • Which assessment is most supportive of the nursing diagnosis, impaired skin integrity related to purulent inflammation of dermal
    10·1 answer
  • Describe How water is tested for color in platinum cobalt method​
    11·2 answers
  • I don't understand HELP!
    7·1 answer
  • Genes that code for proteins that promote the cell cycle and inhibit apoptosis are called _____.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!