Answer:
I believe the answer to be E because it says atom and it is asking what is false about elements.
Explanation:
It is called speciation.
So it'll be D. Speciation
Hope this helped :)
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The conditions listed above are common side effects of DEPRESSANTS. Depressants are drugs which slowed down the central nervous system an the brain. They are usually used to treat anxiety and sleep disorders. Other side effects of depressants include: slurred speech, impaired memory and judgement, lowered inhibition, etc.
If the coyote population decreases then the pika population will increase due to their main threat decreasing. (basically with no one to eat the little guys they will be able to have ALOT of babies)<span />
