1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
3 years ago
14

If grasshoppers were removed from this food web, which organism would suffer the most, the bird or the baboon? Explain answer pl

ease!!!

Biology
2 answers:
dezoksy [38]3 years ago
6 0
Tienes que hacer una dibujo de tu inspiración
viva [34]3 years ago
3 0

Answer:

The bird, it is smaller and will suffer more quickly but if any organism was removed, the whole food web would be disrupted but the bird will probably suffer more than the baboon.

Explanation:

You might be interested in
The pituitary gland is known as the "master gland" because it
lbvjy [14]
The pituitary gland is known as the "master gland" because it is known to control hormones that regulate several other important systems in the endocrine system such as the thyroid gland, ovaries, and testes.
5 0
3 years ago
In Labrador dogs, black coat is dominant to chocolate, normal vision is dominant to progressive retinal atrophy (PRA), and norma
AVprozaik [17]

Answer:

In Labrador dogs, black coat is dominant to chocolate, normal vision is dominant to progressive retinal atrophy (PRA), and normal hip joint is dominant to hip dysplasia. All these genes assort independently. Two dogs that are heterozygous for alleles of all three genes are crossed. Using rules of probability (not a Punnett square), what is the chance that the first pup born to these dogs will be chocolate, have normal vision, and have normal hip joints?

BbVvHh x BbVvHh= BBVVHH, BbVvHh, BbVvHh, bbvvhh

Bb= black coat dominant

Vv= Normal vision dominant

Hh= Normal hip join dominant

probability of having a first born of these dogs will be chocolate, have normal vision and have normal hip joint is 0

Explanation:

As the punette square gives 3:1 phenotype having three black coat, normal vision and normal hip joint and one chocolate, progressive retina altropy and hip dysplasia

3 0
3 years ago
A good model of the cell membrane would be
serious [3.7K]
Could be anything that can help represent the cell membrane visually
5 0
3 years ago
Read 2 more answers
WILL MARK BRAINLEIST IF RIGHT
DochEvi [55]

Answer:

c

Explanation:

6 0
3 years ago
Read 2 more answers
Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis
EleoNora [17]

Answer:

Answer D

Explanation:

just took the test.

4 0
3 years ago
Other questions:
  • Which factor would decrease an area's carrying capacity for prairie dogs? A.Decreased number of diseases B.Decreased availabilit
    7·2 answers
  • How do you keep your plant alive in the winter and indoors? worth 15 points
    7·2 answers
  • HELPPP PLZZZ asapppp plzzzz
    7·1 answer
  • I’m leaning towards C but then again I don’t know. I’m probably wrong
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Sodium molecules are too large to fit through a cell
    14·1 answer
  • PLEASE HELP ME !!!!!
    12·2 answers
  • How long does it take for a dead animal to decompose
    8·1 answer
  • Could anyone help me pls would appreciate it​
    7·1 answer
  • According to the octet rule, if an atom has fewer than 8 electrons in the outer most energy level, what is likely to happen?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!