1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sdas [7]
2 years ago
14

What is the elevation of point B

Biology
1 answer:
Alika [10]2 years ago
5 0

Answer: c. Point B has an elevation less than 2750 feet.

Explanation:

The lines drawn on the map are known as contour lines and they are used to measure elevation. Point B is on a river and rivers are only able to flow at a lower elevation than the area around them.

Point B is therefore lower than the area around it and as the closest contour line to it puts the area at an elevation of 2,750 feet, that must mean that Point B is lower than 2,750 feet.

You might be interested in
Differences in traits such as hair texture are determined by differences in ? A) The location of sugar groups in DNA B)the seque
netineya [11]

Answer:

A

Explanation:

This is called the locus and is determined in Meiosis by gametes from parent cells. During meiosis there is this thing called 'crossing over' where the gametes (sperm and egg cells) homologous genes (genes of similar size and shape, such as X and Y chromosomes or X and X) exchange genes on the same locus to provide slightly different characteristics.

Please check this with your teacher but i believe that this is right. Hope this helps. ;)

4 0
3 years ago
Do all bacteria that grow on blood agar break down the blood
kirza4 [7]
Probably not. some bacteria produce enzymes that break down hemoglobins in RBC.
4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The Y axis of a graph gives the units for the
igor_vitrenko [27]

Answer:

The y-axis of a graph gives the units for the dependent variable.

Explanation:

Dependent variable is the variable being tested and measured in an experiment, it depends on the independent variable.

7 0
3 years ago
Which of the following could be considered
Lemur [1.5K]

Answer:

considered what? the question was not finished

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which chemicals involved in cellular respiration are also found in the respiration of animal organisms and humans
    5·2 answers
  • Assume saccharomyces cerevisiae is grown in a nutrient medium containing the radioisotope 35p. After a 48-hour incubation, the 3
    8·1 answer
  • What kingdom, phylum, class, order, family, genus, and species each bird is:
    7·1 answer
  • 27. If there is a full moon on Sept. 13, When is the next full moon?​
    9·1 answer
  • Which of the following statements concerning photosynthesis is NOT true?
    7·2 answers
  • How do the outer planets compare to inner ones
    7·1 answer
  • Which two organelles are not found in an animal cell but are found in a plant cell?
    8·2 answers
  • Energy is conserved when thermal energy is transferred from your body to a coat.
    9·2 answers
  • The work of Charles Darwin and Alfred Wallace on the origin of the Earth's species extended the ideas of Lyell's uniformitariani
    13·1 answer
  • How do scientists determine the relative age of a rock or fossil
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!