1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovangra [49]
3 years ago
12

PLEASE CAN SOMEONE HELP ME???

Mathematics
1 answer:
RideAnS [48]3 years ago
3 0

Answer:

-8,4 and 4,-5

Step-by-step explanation:

You might be interested in
Dating whats your opinion
Taya2010 [7]

Answer: i'd rather stay single. none of yall loyal like you say. i only chase the bag.  

Step-by-step explanation:

8 0
3 years ago
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
If the following is an exponential growth function, f(x)=3(A)^x , what can the value of A be? Select all that apply.
mixer [17]
The answer can either be 1.25 or 2. As long as the value of A is greater than 1, the function is an exponential growth function.
6 0
3 years ago
Read 2 more answers
A man has twin sons of equal height. The combined
Anuta_ua [19.1K]

Answer:

son weight = 72

Step-by-step explanation:

D + S = 180

D + 2S = 252

S=252-180

S = 72

D= 108

3 0
3 years ago
When our brains store information, complicated chemical changes take place. In trying to understand these changes, researchers b
Rainbow [258]

Answer:

D) P-045 says that a response this small or smaller would be seen in sample data almost half the time when in fact there is no effect in the entire population of rats. That is, a response this size would often happen just by chance.

Step-by-step explanation:

The P-value represents the probability of getting the test sample results given that the null hypothesis is true.

A P-value that is low enough (smaller than the significance level) gives statistical evidence to support that the null hypothesis is not true.

In this case,  a P-value of 0.45 does not represent a strong evidence against the null hypothesis, as there is 45% of chances of getting this sample results if the null hypothesis is true.

In this case, as we talk about differences ("no difference was seen" between the two groups), we know that the sample difference has not been large enough to be proved statistically significant.

So the right answer is Option d).

8 0
3 years ago
Other questions:
  • Evaluate each expression <br><br> 10 (e+7)<br> E=3
    7·2 answers
  • What is the slope of the line in the graph?<br> 4<br> +<br> -<br> 54-3
    6·1 answer
  • How do i solve these?
    11·1 answer
  • A cylinder has a radius of 8 cm and a height of 14 cm.
    14·1 answer
  • Simplify 11^3 ÷ 11^3 · 11^3
    10·1 answer
  • 20 PTS+BRAINLIEST:
    10·2 answers
  • A line passes through the point (4, -2) and has a slope of 1/2. What is the value of A if the point (-4,a) is also on the line?
    12·1 answer
  • The probability distribution for a
    8·1 answer
  • The base of triangle M is four times the base of tri-
    15·1 answer
  • Need help asap! Please and thank you
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!