1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nignag [31]
3 years ago
9

Which option identifies the most likely contributor to a microclimate that forms in a northern-facing valley?

Biology
2 answers:
Ronch [10]3 years ago
6 0

Answer:

Topography

Explanation:

I just took the quiz.

viva [34]3 years ago
6 0

Answer: pretty sure it’s topography

Explanation: edge 2021

You might be interested in
What percentage of fungi uses photosynthesis to make their own food? 0%, 15%, 50%, or 100%
garik1379 [7]
0%. Fungi are heterotrophs, meaning that they get their food from elsewhere instead of making it themselves.
4 0
3 years ago
This map of the United States is an example of a .____
zlopas [31]

Answer:

i need a picture to know

Explanation:

4 0
2 years ago
A new and effective antibiotic becomes widely used for a particular species of bacteria. After some time, an antibiotic-resistan
s2008m [1.1K]
Antibiotic resistance happens when an antibiotic lost its ability in controlling or killing bacterial growth. At this moment the bacteria are already resistant to the antibiotic and are multiplying even though the drug is present. This is a natural phenomenon.
4 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Identify the missing numbers 5.6 × 1012 / 3.5 × 109 = A × 10B A= B=
AnnyKZ [126]

Answer:

A= 1.6

B= 3

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • SOMEONE PLEASE ANSWERRR!!!
    13·1 answer
  • A celestial body has these properties: It is too small to clear objects that are in its orbital path. It has a rocky surface but
    14·2 answers
  • Which temperature generated the greatest oxygen production?
    8·1 answer
  • What is in a bacterial cell
    15·2 answers
  • 9. Which is a monomer of a protein?
    9·1 answer
  • What initiates translation
    8·1 answer
  • Witch would have most likely stopped mendla from finding a pattern in his results
    13·1 answer
  • Which of the following can occur around a subduction zone?
    6·1 answer
  • Please help me out I'm being timed for this plz look at the picture of the question please and thank you
    10·1 answer
  • Both the Psoas major muscle and iliacus muscle insert on the __________. intertrochanteric crest greater trochanter of the femur
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!