1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nignag [31]
3 years ago
9

Which option identifies the most likely contributor to a microclimate that forms in a northern-facing valley?

Biology
2 answers:
Ronch [10]3 years ago
6 0

Answer:

Topography

Explanation:

I just took the quiz.

viva [34]3 years ago
6 0

Answer: pretty sure it’s topography

Explanation: edge 2021

You might be interested in
Pyruvate dehydrogenase is regulated by feedback inhibition and covalent modification. Which molecules inhibit the pyruvate dehyd
Oksi-84 [34.3K]

ADP, NAD+, CoA-SH, and pyruvate are the molecules that inhibit the pyruvate dehydrogenase complex.

<h3>What is pyruvate dehydrogenase complex?</h3>

PDC3 triggers the oxidative decarboxylation of pyruvate, resulting in the creation of acetyl-CoA, CO2, and NADH.

The PDC plays a crucial role in the oxidation of glucose by connecting the glycolytic pathway to the tricarboxylic acid cycle's oxidative pathway.

ADP, NAD+, CoA-SH, and pyruvate all inhibit it. PDK prevents glycolysis from being coupled to GO by inhibiting its target enzyme PDH.

Thus, the answer is ADP, NAD+, CoA-SH, and pyruvate .

For more details regarding pyruvate dehydrogenase, visit:

brainly.com/question/16346028

#SPJ4

3 0
2 years ago
An object Unless acted upon by an outside unbalanced force
Alexxandr [17]
Will remain at rest or stay in motion. That's Newton's first law of motion
6 0
3 years ago
What is cognitive therapy
alexandr1967 [171]

Answer:

cognitive therapy is a type of psychotherapy to treat human mood disorders such as depression.

hope it helps!

4 0
3 years ago
Read 2 more answers
An ______ is an animal that obtains its body heat from the environment
son4ous [18]

Answer: Ectotherm

Definition: An animal that is dependent on <u>external sources of body heat</u>.

6 0
3 years ago
Which statement accurately describes the 13 American colonies?
NARA [144]

Answer: C

Explanation:

7 0
2 years ago
Other questions:
  • The _______ is responsible for cellular respiration in eukaryotic cells
    13·1 answer
  • What does it mean for an organism to be anaerobic
    15·2 answers
  • Science helps people learn about the way the world works. What is the goal of technology?
    13·2 answers
  • What is the average weight of a great white shark
    15·2 answers
  • Which of the following observations contributed to the cell theory?
    13·2 answers
  • Which is the best way to describe how cells get nutrients?
    8·2 answers
  • Please explain me what about osmosis!
    10·2 answers
  • How do you receive ADA (attendance) credit?​
    10·1 answer
  • Which behavior is a response that is determined by heredity?
    12·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!