Answer:
All of the genes controlling the traits behaved as if they were located on different chromosomes.
Explanation:
Mendel's experiments with pea plants lead to two principles:
- Law of segregation which states that the pair of alleles (for any trait) of each parent separate, meaning that one allele passes from father and another from mother to an offspring.
- Law of independent assortment which states that different pairs of alleles (for different traits) are passed to offspring independently of each other (traits are located on different chromosomes).
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Im going to say O2..but im not 100% sure
The components that are part of the bone matrix are as follows:
<h3>What is the bone matrix?</h3>
The bone matrix is that part of the bone tissue that forms most of the mass of the bone.
The bone matrix is comprised of organic and inorganic substances. The organic component of the bone matrix includes the following:
However, the inorganic component is mainly;
inorganic bone salts
hydroxyapatite
Therefore, the components that are part of the bone matrix are as follows:
- Osteoid
- Calcium salts
Learn more about components of bone matrix at: brainly.com/question/9619090
#SPJ1
