1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
8

What releases carbon dioxide into the atmosphere​

Biology
1 answer:
IRISSAK [1]3 years ago
4 0

Answer:

Carbon Dioxide Emissions: Human Sources

<h2>Human activities such as the burning of oil, coal and gas, as well as deforestation are the primary cause of the increased carbon dioxide concentrations in the atmosphere.</h2>

You might be interested in
Where does cellular respiration occur? (1 point)
Bess [88]

Answer:

Mitochondria

Explanation:

Plants.

8 0
3 years ago
Read 2 more answers
What would happen if there was a sudden increase in the amount of greenhouse gases in Earth's atmosphere​
Harrizon [31]

There would be a much more severe cause of global warming if there is a sudden increase in greenhouses gases. With greenhouse gasses such as carbon dioxide, the heat of the earth cannot be penetrated through the atmosphere and will be trapped, the sunlight also cannot be reflected.

3 0
4 years ago
The consumer price index measures approximately the same economic phenomenon as
kati45 [8]

Answer:

The GPD deflator

7 0
3 years ago
What are chromosomes?
Bas_tet [7]

Answer:

chromosomes of a cell are in the cell nucleus. They carry the genetic information. Chromosomes are made up of DNA and protein combined as chromatin. Each chromosome contains many genes. Chromosomes come in pairs: one set from the mother; the other set from the father.

6 0
3 years ago
Read 2 more answers
How does the presence of a mid ocean ridge most likely affect the nearby ocean currents?
Harlamova29_29 [7]

Answer: C. It changes the course of deep ocean currents

Explanation: deep ocean currents consists of cold water flowing slowly across the ocean floor

6 0
3 years ago
Other questions:
  • Select the correct answer.
    7·1 answer
  • What are the three properties of water that are unique to the conditions found on earth
    13·1 answer
  • What is An example of dehydration synthesis
    5·1 answer
  • Why do amoebas change shape?
    12·1 answer
  • What are two body systems that are used to heal a broken bone?
    8·2 answers
  • I am a human cell with 92 chromosomes. I still have a nuclear membrane. Where am I in the
    15·1 answer
  • Dr. Haxton says the o-o bond is polar and the c-c bond is nonpolar. A good student would say ...
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Question 4 I need help with
    14·1 answer
  • When the vasomotor center of our brain wishes to increase blood pressure, it increases ____________ signals causing ______.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!