1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
swat32
3 years ago
6

Question 1 of 10

Biology
1 answer:
Artist 52 [7]3 years ago
5 0
It is B a cube is the answer
You might be interested in
Explain how and why you would conduct a study to determine if this bone can be used to determine sex
Hatshy [7]

Answer:

The pelvis is the best sex-related skeletal indicator, because of distinct features adapted for childbearing. The skull also has features that can indicate sex, though slightly less reliably. Males have a square jawline and the line between the outer edge of the jaw and the ear is vertical. Conversely, in females the jaw is much more pointed and the edge of the jaw slopes gently towards the ear.

Explanation:

3 0
3 years ago
Where in the cell does translation take place
frutty [35]
Translation occurs in the cytoplasm
5 0
4 years ago
Read 2 more answers
What can we infer from the stickleback fossil record about evolutionary processes occurring today?
s2008m [1.1K]
<h3><u>Answer;</u></h3>

Evolutionary patterns observed in the fossil record are consistent with evolutionary processes occurring today.

<h3><u>Explanation;</u></h3>
  • Three spine stickleback is a model organisms for studies in evolution because; Stickleback fish are small and have short generation times. These two characteristics make them easy to keep in a lab and useful for conducting genetic studies, since researchers can follow several generations of fish in a relatively short time.
  • Also, stickleback fish populations occur throughout the Northern Hemisphere in a wide range of environments, so researchers can compare different populations and study how they have changed over time in response to different environmental pressures.
3 0
3 years ago
Life on Earth originated from primitive
lys-0071 [83]
I believe the correct answer from the choices listed above is the last option. Life on Earth originated from primitive bacteria. <span> It is generally agreed that all </span>life<span> today evolved by common descent from a single primitive lifeform and the lifeform from the choices is bacteria. Hope this helps.</span>
6 0
4 years ago
is the following statement true or false? the mountain zebra ( equus zebra) and the donkey ( equus asinus) belong to the same sp
emmasim [6.3K]

False. The mountain zebra and the donkey do not belong to the same species.

<h3>What are species?</h3>

The species represent the lowest and narrowest taxonomic categories as far as the classification of living organisms is concerned.

A species represents a group of organisms whose mating will lead to the production of valid offspring.

Thus, no two different organisms can bear the same species name unless they can mate and produce fertile progenies.

What the mountain zebra and the donkey share is the genus name, not the species name. Different species of organisms can bear the same genus name as far as taxonomy is concerned.

More on taxonomy can be found here: brainly.com/question/19184314

#SPJ1

8 0
2 years ago
Other questions:
  • Which statement correctly describes the nucleus of the atom?
    9·2 answers
  • Grandpa Sam used to tell his grandkids how he first laid eyes on Grandma Sylvia. “When I was courting your granny, I was dazzled
    14·1 answer
  • Explain what an inhibitor is and what it does
    5·1 answer
  • One way to describe a species is as a population adapted to a certain niche. That population has a small gene pool. If the membe
    11·1 answer
  • Which of the following statements is true?
    13·1 answer
  • Please help me. I been stuck on this question for a long time :(​
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of these statements is true about carbon and its isotopes
    8·1 answer
  • Will someone please help me??
    10·1 answer
  • Interesting biology project topic ​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!