1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mkey [24]
3 years ago
9

Which phrase best describes what a soil horizon is?

Biology
1 answer:
katen-ka-za [31]3 years ago
7 0

Answer:

B. Each layer of a soil profile

Explanation:

I took the test and got it right

You might be interested in
Please help! (Maybe Astute?) I will mark as brainliest if it is correct!!! please help!!!! I really need it ASAP!!!
borishaifa [10]
As the sun heats the surface of the oceans, two layers of water result. These layers are separated by the Thermocline. 

so your answer is thermocline. 
6 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which two characteristics of living things do viruses exhibit?
LuckyWell [14K]

Answer:

Viruses exhibit two out of above mentioned which are

1. They contain genetic information

2. They reproduce

Explanation:

Viruses can be classified as either living or non living organisms

They can be classified as living organisms because of the following reasons

1. They can mutate

2. They can grow

3. They evolve to adapt to their hosts

4. They are capable of multiplication in their host cells

5. They are made up of proteins and glycoproteins like cells do

6. They have genetic information which helps them to produce more viruses in the form of either RNA or DNA.

They can also be classified as non living organisms because

1. They can not exist outside their host cell

2. They do not carry out metabolism, they make use of their host mechanisms

8 0
3 years ago
Where is starch in plant cells? In KS4 levels please!
ludmilkaskok [199]

Answer:

Starch can be stored in places like  amyloplasts or chlorpasts

4 0
2 years ago
What are the 3 types of muscles in the human body. Where are they found in the body?
Sonja [21]

Answer:

In the muscular system, muscle tissue is categorized into three distinct types: skeletal, cardiac, and smooth. Each type of muscle tissue in the human body has a unique structure and a specific role. Skeletal muscle moves bones and other structures. Cardiac muscle contracts the heart to pump blood.The 3 types of muscle tissue are cardiac, smooth, and skeletal. Cardiac muscle cells are located in the walls of the heart, appear striated, and are under involuntary control.

Explanation:

4 0
3 years ago
Other questions:
  • If a plant has a mutation and cannot produce Casparian strips, what process won't it be able to do?
    13·2 answers
  • Which is a tough and flexible layer that surrounds plant cells, as well as some algal and bacterial cells.
    11·2 answers
  • Descrube 4 components of proper collection of soil
    5·1 answer
  • Al + O2 ---&gt; Al2O3<br><br><br><br> Balance the chemical equation.
    13·1 answer
  • Describe one function that is common to both carbohydrates and lipids.
    7·1 answer
  • A divide as it relates to Earth science is the
    14·1 answer
  • After fertilization cells as seen here divide repeatedly. The next step in the development of a multicellular organism would be?
    11·2 answers
  • 1. What might cause an increase or decrease of carbon dioxide in a given location such as in the atmosphere or buried under grou
    5·1 answer
  • If you help me ill mark you brainliest​
    12·1 answer
  • Name the three fossil fuels and tell how Americans use them and the impact they have on our country?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!