1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Finger [1]
3 years ago
15

Why would glucose uptake increase during exercise?

Biology
1 answer:
lesya692 [45]3 years ago
8 0

Answer:A

Explanation:

You might be interested in
Why does vineger and baking soda react.
Luba_88 [7]
The carbon dioxide escapes, and bubbles forth as a gas. Baking soda and vinegar react<span> with each other because of an acid-base </span>reaction<span>. </span>Baking soda<span> is a bicarbonate (NaHCO3) and </span>vinegar<span> is an acetic acid (HCH3COO)</span>
5 0
4 years ago
Read 2 more answers
Linked genes are genes that Select one: a. assort independently. b. segregate equally in the gametes during meiosis. c. always c
nexus9112 [7]

Answer:

d. are found on the same chromosome

Explanation:

Linked genes are genes that <em>sit close together on the same chromosome,</em> this closeness makes higher the probability to inherit them together, meaning they won't follow Mendelian inheritance. Considering this information we can conclude that the correct answer is d. are found on the same chromosome.

I hope you find this information useful and interesting! Good luck!

4 0
3 years ago
How to write 778,000,000 in scientific notation
Anestetic [448]

To answer the question what is 77800000 in scientific notation let’s recall how to convert 77800000 to scientific notation as detailed on our home page.

When you split the number 77800000 into a coefficient and a power of 10 you do get 77800000 in exponential form, but there is an indefinite number of possibilities.

As you probably want 77800000 in normalized scientific notation, the coefficient or significand of 77800000 in scientific notation must be in the interval [1,10[.

As there are many ways to express 77800000 in scientific notation, in this post we mean 77800000 in normalized scientific notation, unless stated otherwise. Therefore:

77800000 in scientific notation = 7.78 × 107.

8 0
3 years ago
Read 2 more answers
If you have TT, will you look dominant or recessive
adelina 88 [10]
Dominant. Lowercase would be recessive.
5 0
3 years ago
Read 2 more answers
Based on the name of this organism, what can you predict about its morphology?
Mnenie [13.5K]

Answer:

<em>S. aureus</em> is spherical and arranged in clusters

Explanation:

<em>Staphylococcus aureus </em>is a gram positive bacteria that forms a part of our body microbiota. It is usually found on skin and in upper respiratory tract. The genus name of this organism is <em>Staphylococcus </em>which tells a lot about its morphology. Cocci or coccus is the name given to bacteria who appear spherical. Staph points out to their arrangement which is in clusters. Had it been <em>Streptococcus</em>, it would mean that the bacteria were spherical and arranged in long chains. Similarly, <em>Diplococcus</em> would mean that the bacteria were spherical and arranged in groups of two. Hence from the name <em>Staphylococcus aureus </em> we can say that it is spherical and arranged in clusters.  

7 0
3 years ago
Other questions:
  • How much does a 2 liter bottle of water weigh​
    13·1 answer
  • When ATP is hydrolyzed, are you adding water or removing it? Explain 20 points I’ll do brainlest too
    8·2 answers
  • Paramecium are classified into which of the following categories
    13·2 answers
  • A client has an above-the-knee amputation of the left leg because of arterial insufficiency. to prevent a hip flexion contractur
    5·2 answers
  • Which one of these is an autograph 1)consumer 2)producer 3)carnivore 4)herbivore
    13·2 answers
  • PLEASE HELPPPPP!!!!!!!!!!!!!!
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Write a claim: Can mixtures be separated?<br><br> Please I need this done by tomorrow!!
    10·2 answers
  • State whether Benedicts test can be carried out to a solid food sample. If the food sample is a solid what should be done?
    11·1 answer
  • Describe the data used by Watson and Crick to determine the structure of DNA
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!