1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11Alexandr11 [23.1K]
3 years ago
7

A pedigree is shown above that tracks a trait through four generations in a family. Based on the inheritance patterns of this tr

ait, which statements accurately justify that this is a sex-linked recessive trait? Select all that apply.
A) Individuals 1-1 and 11-4 are carriers.
B) The trait is passed from fathers to sons.
C) Males are being affected more frequently than females.
D) The trait is expressed on a chromosome other than the X or Y.
E) The trait appears in later generations after being absent in one generation.
Biology
1 answer:
Katarina [22]3 years ago
8 0

Answer:

The answer above is only one of the answers. The answers are A, C, and E! I did the USATestPrep and those were the answers. Mark as brainliest plz!

Explanation:

You might be interested in
What does the body do during the exhaustion phase of the GAS model? It prepares to fight danger or run from it. It identifies th
ki77a [65]
It prepares to fight danger or run from it. It identifies the primary source of danger.

8 0
3 years ago
Read 2 more answers
Classification of Living Organisms Common Name Bush Anole Crested Penguin Ferret Muskrat Kingdom Animal Animal Animal Animal Phy
jekas [21]

Answer:

c

Explanation:

4 0
3 years ago
Anyone please banned my account​
zmey [24]

Answer:

you go to settings and tap on log out option to exit this account

7 0
3 years ago
Read 2 more answers
Carlos set up three full vials beside one another and added drops to see the
sdas [7]

Answer:

D

Explanation:

just did it

8 0
3 years ago
Little Joey jumps into a pool on a cool fall morning. How can we describe the direction of energy transfer and temperature chang
julia-pushkina [17]
The direction of energy is hot to cold. So Joey’s thermal energy is moving from him to the water with convection.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Describe how you can tell if something is alive
    6·1 answer
  • Crossing over occurs when
    15·2 answers
  • Please help me i need this asap<br> Question 5 A and B
    9·1 answer
  • Jessica is traveling from Chicago, Illinois, to Miami, Florida. Using the map, tell what will happen to the land as she travels
    15·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • If scientists determine the age of a rock to be three billion years old, what else do they know? A) the rock came from outside t
    15·2 answers
  • which program created during g president Johnsons administration focuses on providing health coverage to elderly
    11·1 answer
  • Gasses that contribute to the greenhouse effect
    12·1 answer
  • What are the four letters of the rna alphabet
    13·1 answer
  • Which layer do you usually see in photographs of the sun
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!