1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Triss [41]
3 years ago
12

Which one best describes herbivores

Biology
2 answers:
saul85 [17]3 years ago
7 0

Answer:

An herbivore is an organism that mostly feeds on plants. Herbivores range in size from tiny insects such as aphids to large, lumbering elephants. Herbivores are a major part of the food web, a description of which organisms eat other organisms in the wild.

trapecia [35]3 years ago
3 0
A herbivore eats plants not other animals
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
What are the correct steps in the transformation of a sedimentary rock into a metamorphic rock? rock eroded away and deposited i
zaharov [31]

Answer:

hey...im not sure about the answer but i think it is the 2nd option which is: rocks buried deeply and melted by intrusion rock erodedaway and deposited in ocea n base

hope it helps

5 0
3 years ago
1 A wound that is deeper than wide, can cause damage to internal organs describes a(n)
dusya [7]
It is A.
Laceration.
6 0
2 years ago
Read 2 more answers
Which of the following are hair-like structures used to move materials within the cell?
marusya05 [52]

Answer:

flagella and cilia

Explanation:

Flagella (singular = flagellum) are long, hair-like structures that extend from the plasma membrane and are used to move an entire cell, (for example, sperm, Euglena).

I hope you like this

5 0
3 years ago
Please help with answer
vichka [17]

Answer:

The first Bubble.

Explanation:

5 0
3 years ago
Other questions:
  • After watching the squirrels at the local park for several days, Sergei asks his science teacher the following question: "Do mor
    6·2 answers
  • Which of the following is the path of a nerve impulse through a neuron? A. terminal branches - axon - cell body - dendrite B. de
    13·2 answers
  • A food chain or food web can provide good information including _____.
    5·1 answer
  • Which element has seven energy levels the only one valence electron
    5·1 answer
  • In about 90% of cases, Huntington’s disease is inherited. But in 10% of cases, there is no evidence that a parent has the diseas
    15·2 answers
  • ___ Is the movement of a liquid along a solid because of this property of water know as___ select 2 choices
    8·1 answer
  • Describe how the action of the action of the mouth,aesphogus and stomach contribute to the digestion of food
    7·1 answer
  • Why is development work necessary for the development of nation?​
    8·1 answer
  • Please!! I’ll give you lots of points!! PHow do the sensory spines most likely help the cockroach
    15·1 answer
  • How are transgenic animals different from knockout animals?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!