1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
2 years ago
13

ATP-

Biology
1 answer:
Verizon [17]2 years ago
3 0
B . is essential for a cell to perform all the tasks necessary for life. :))))
You might be interested in
An autoimmune disease is:_________
Irina18 [472]
The answer u r looking for is- D* failure of the immune system to distinguish self from nonself. Hope I’ve helped ;)
8 0
3 years ago
What is the orthognathous face???​
MrRa [10]

Answer:

(especially of a person) having a jaw that does not project or recede so that the facial profile is nearly vertical

Explanation:

its my brainliest answer

i think it could help

7 0
3 years ago
The process by which a cell divides into two daughter cells is called
rewona [7]
This process is called mitosis
6 0
3 years ago
Read 2 more answers
Resource a squrriel might need
olchik [2.2K]
1.) food
2.) water
3.) a habitat
4 0
3 years ago
3. Which statement correctly defines digestion?
mixer [17]

Answer:

B) Digestion is the process of breaking down food into smaller molecules.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • (a) if the seawater carbonate ion concentration is 270 ?mol/kg, what is the approximate rate of calcification, and approximately
    8·1 answer
  • Explain why earthquake and volcanoes appear in generalized belts around the planet the planet
    15·1 answer
  • Which gland of the endocrine system is located near the brain? A. pituitary gland B. thyroid gland C. adrenal gland D. pancreas
    10·2 answers
  • 14. A structure with a chain of carbons and hydrogens with a COOH at the end will represent which of
    8·1 answer
  • .
    9·1 answer
  • Que le falta a Puerto Rico para ser un pais sustentable?
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Explain which direction the molecules will move during diffusion?
    11·2 answers
  • Which statement best summarizie the principle of fanul succession
    10·1 answer
  • Black fur (B) in guinea pigs is dominant over white fur (b). What is the probability of finding homozygous black offspring in a
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!