1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
5

Forest fires can cause a secondary disturbance in an ecosystem what is a secondary disturbance

Biology
2 answers:
nataly862011 [7]3 years ago
8 0

Answer:

A progressive series of changes that take place in an area where a

community is living.

Explanation:

Mrrafil [7]3 years ago
3 0

Answer:

important to remember that the so called “secondary” disturbance is secondary only because it occurs second sequentially.

Explanation:

hope it helps

You might be interested in
One of Mendel’s principles also describes how different genes assemble unregulated with one another when reproductive cells deve
Lisa [10]

Ansnswer:

False.

No Mendel principled talk about how different genes assemble unregulated with one another to develop reproductive cells

Explanation:

Gregor Mendel was a scientist and the founder of modern science genetics. He made so findings in 1865 and He proposed three laws and they are;

Law of independent assortment which states that two alleles from different genes separated independently to form gamete.

Law of segregation states that a pair of gene separated to for reproductive cells.

Law of dorminant inheritance states that in heterozygote, dorminant allele will masked the recessive allele.

5 0
3 years ago
Read 2 more answers
Which traits do you think are very strictly determined by your genetic make-up (genotype)?
zvonat [6]

Answer:

Reproduction, growth and development, regulation, homeostasis, and energy processing.

Explanation:

Reproduction, growth and development, regulation, homeostasis, and energy processing are the traits or characteristics that are determined by the genotype. These traits are under the control of genes of an organisms and can be changed if the change in the genes occurs while on the other hand, the physical characteristics of an organisms are determined by phenotype means phenotype is responsible for the appearance of an organisms.

7 0
2 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
The simplest structured unit of a compound is a(n):<br> electron<br> atom<br> proton<br> molecule
tiny-mole [99]
The answer is molecule
8 0
3 years ago
Read 2 more answers
What problems can occur while your immune system fights the corona virus? <br>plz help me ASAP
Kipish [7]
You could possibly experience some serious health problems or even worse possibly die but if you take care of yourself or go to the doctor with time you will have a better chance at surviving Corona
3 0
3 years ago
Other questions:
  • The diagram below shows a food web.
    6·2 answers
  • Using the five-digit system, determine the obstetric history in this situation: the client is 38 weeks into her fourth pregnancy
    6·2 answers
  • 19.
    15·2 answers
  • You are given a slide of a pathogen that is Gram-negative and whose subcellular structures can be observed with a light microsco
    10·1 answer
  • For an amino acid such as alanine, the major species in solution at pH 7 is the zwitterionic form. Assume a p K a value of 8 for
    14·1 answer
  • According to the phylogenetic tree, which phylum of organisms are most closely related to chordates?
    10·1 answer
  • After firing a short burst of action potentials in an axon, researchers observe a larger EPSP in the postsynaptic cell, and this
    15·1 answer
  • Why are there two copies of each chromosome? Question 5 options: One copy comes from each parent Chromosomes were duplicated in
    8·1 answer
  • A . producers <br> B . Consumer <br> C. Bacteria
    12·1 answer
  • Which of the following planets has the largest orbital radius compared to the others?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!