1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
3 years ago
6

20

Biology
1 answer:
hjlf3 years ago
4 0
Uptake of water by root hairs is not an example of active transport but an example of osmosis.

If answer was helpful mark as brainleast plzzz
You might be interested in
Which of the following is a result of elevated levels of white blood cells and reduced levels of red blood cells in the body? (2
alexandr402 [8]

Answer:

Efficiency of oxygen transport is reduced due to an infection.

Explanation:

7 0
3 years ago
Which best describes the flow of genetic information. A= genetic information is carried only by dna. B= genetic information flow
alexandr1967 [171]
The answer is C=genetic information flows from DNA to RNA to protein
6 0
3 years ago
Read 2 more answers
Nirenberg and leder used synthetic ‘triplets’ of rna. The purpose of these short rna molecules was to.
dmitriy555 [2]

Take the place of part of an mRNA within the ribosome.

Rna triplets

The nucleotide sequence copy of a gene is present in the mRNA. Each amino acid is represented by a triplet of the four nucleotide bases that make up the genetic alphabet. The relationship between triplet sequences and amino acids is known as the genetic code.

A codon is a triplet of RNA nucleotides that codes for a particular amino acid. To the ribosome, where translation takes place, the tRNA transports certain amino acids. During translation, the anticodons in the tRNA bind to the codons in the mRNA templates. It is essential for the codon and anticodon to interact in order to pair the codon with the appropriate amino acid.

In mRNA, each trio of nucleotides is referred to as a codon, and each codon designates a certain amino acid (hence, it is a triplet code).

To know more about RNA visit:
brainly.com/question/25979866
#SPJ4

7 0
1 year ago
Endosymbiosis of cyanobacteria is widely accepted as an explanation for the development of chloroplasts. The presence of endosym
lilavasa [31]

Answer:

The correct answer is- photosynthesis

Explanation:

According to the endosymbiotic theory, an ancestral cell engulfed a cyanobacteria and lived in symbiotic association with that bacteria and over time this bacteria evolved into the chloroplast and the ancestral cell developed into plant cell.

So as cyanobacteria was the first aerobic cell that can evolve oxygen and can do photosynthesis to produce organic food so it could be concluded that the presence of endosymbiotic cyanobacteria provided a cell with the advantage of photosynthesis.

3 0
3 years ago
_____ is the asexual reproduction process conducted by coral and yeast.
faltersainse [42]
Budding is the asexual reproduction process conducted by coral and yeast
5 0
3 years ago
Other questions:
  • Which cell has both a cell wall and a cell membrane?<br><br> please answer quickly its urgent
    11·1 answer
  • Five examples of cells in plants and animals​
    6·2 answers
  • Please let me know as soon as possible
    7·1 answer
  • If a germ cell with 38 chromosomes undergoes meiosis, how many chromosomes will the resulting cells have?
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • In a farming accident last year, kevin injured his right cerebral hemisphere. this injury may impair kevin's ability to:
    5·1 answer
  • Cuantos huesos pares tiene el craneo
    14·2 answers
  • What is difference in scale between a human cell and a virus.
    6·1 answer
  • TIME SENSITIVE question!! I WILL GIVE BRAINLIEST
    6·1 answer
  • Solar panels convert light energy from sunlight into electrical energy. What material is most likely used in solar panel
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!