1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
2 years ago
12

HELP, define genetic engineering and Describe how DNA is modified for use in genetic engineering.

Biology
1 answer:
Xelga [282]2 years ago
6 0

Answer:

Genetic engineering is deliberate modification of genome to gain desired traits.

The main steps of genetic engineering:

Restriction enzymes are used to isolate the required gene leaving it with sticky ends. Sticky ends are a short section of unpaired bases A vector, which is usually a bacterial plasmid or a virus, is cut by the same restriction enzyme leaving it with corresponding sticky ends. The vector and the isolated gene are joined together by ligase enzyme. The vector inserts the gene into required cells. The genes are transferred to animal, plant or microorganism cells, during early development, which allows them to develop with the desired characteristics.

You might be interested in
Explain with scientific reason that origin of life was associated with some chemical reactions.​
Hunter-Best [27]

Answer:

Darwin's theory of biological evolution tells us that all life on earth may have originated from a single, relatively simple reproducing creature living in the distant past. This idea is based on many observations, one of which is that when living things reproduce, children are often born with random new traits.

Explanation:

5 0
2 years ago
Which statement is true about DNA replication? (2pts)
Fittoniya [83]
<span>DNA replication involves unzipping the DNA molecule, followed by base pairing, which adds complementary nucleotides, to form two new identical DNA molecules that move to the new cells during cell division.</span>
7 0
3 years ago
Read 2 more answers
Asexual reproduction results in offspring that are genetically identical to their parent. what type of cell process commonly occ
madreJ [45]
Ion know this .. Ask Google.
7 0
3 years ago
Why is it a good idea to wait at least an hour between eating and exercising?
Delvig [45]
This is because you have to let your food digest a bit before continuing your work out to prevent cramps and this like that.
8 0
3 years ago
Read 2 more answers
How do convergent and divergent cause limbs to envole ?
krok68 [10]
Divergent evolution is when two different species share the same ancestral origins but have evolved differently whereas convergent evolution is when species with different ancestral origins have developed similar features.

In convergent evolution, two species that are not necessarily closely related develop similar features often as a result of adaptation to similar conditions.
3 0
3 years ago
Other questions:
  • What term refers to organisms magnified with a microscope
    8·1 answer
  • How do you think the change in
    8·1 answer
  • In algae and plants, photosynthesis happens in the
    5·1 answer
  • What is substrate-level phosphorylation?
    6·1 answer
  • What are some examples of microorganisms
    6·1 answer
  • Which plant can help remove pollutants in rivers and lakes?
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Picturee is b e l o w DONT REPORT IT OR ELSE ILL TRACK UR ACCT DOWN AND SPAM YOU thank you :&gt;
    15·2 answers
  • After vigorous exercise, the muscles involved show a marked the increase in the concentration of
    12·1 answer
  • Amphibians were diverse and abundant in the lush swamp forests of the ________, which is sometimes referred to as the age of the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!