1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
6

(6p+4)+(-5p+8) Plz i need help

Mathematics
2 answers:
Oksana_A [137]3 years ago
7 0

Answer:

p+12

Step-by-step explanation:

I'm assuming you want me to simplify this equation. Okay, first, we eliminate the redundant parenthesis. Now, we have 6p+4+-5p+8, we can simplify this to 6p+4-5p+8 because adding a negative has the same effect as subtraction. Now, we combine like terms (6p and -5p, and 4 and 8). From this, we have 1p+12 (4+8=12, and 6p-5p=1p, or just p). We can simplify this even more to get p+12. I hope this helps!

dmitriy555 [2]3 years ago
4 0
The solution is p + 12.
You might be interested in
Solve 6x - 3y = 12 for y<br> A. y = 6x + 4<br> B. y = 2x - 4<br> C. y = -6x + 12<br> D. y = 2x - 12
DedPeter [7]

Answer: <em>y = 2x − 4</em>

The correct answer is <em>B)</em> <em>y = 2x − 4</em>

Step-by-step explanation:

<u>Move all terms that don't contain y to the right side and solve:</u>

<em>y = −4 + 2x</em>

<u>Then reorder −4 and 2x:</u>

<em>y = 2x − 4</em>

<u>Final answer is:</u>

<em>B) y = 2x − 4</em>

8 0
2 years ago
Read 2 more answers
Please help!! QUESTION IS BELOW
Andrew [12]

Answer:

Step-by-step explanation:

√((5-1)²+ (4 - (-6))²

√(4)² + (10)²

√(16+100)

√116

2√(29)

8 0
2 years ago
PLEASE HELP ILL REWARD BRAINLIST
kodGreya [7K]

Answer: (2,1)

Hope it helps <3

7 0
4 years ago
Read 2 more answers
Solve for x<br> Enter the solutions from least to greatest.<br> -4x^2– 7 = -11
Pavlova-9 [17]

Answer:

x = 1, x = -1

Step-by-step explanation:

-4x² = -4

x² = 1

x = \sqrt{1}

x = ±1

3 0
3 years ago
A hula hoop measures 14 inches from the center to the outside. What is the distance around the hula
Paladinen [302]

Answer:

43.96

Step-by-step explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Inez Walks 1.85 mi in 45 minutes , how many miles can she walk in 1 hour?
    15·1 answer
  • Identify the x- and y-intercepts for x=3.
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Use the normal approximation to the binomial distribution to answer this question. Fifteen percent of all students at a large un
    12·1 answer
  • There are 5,280feet in a mile. Factoid of the day: The longest wedding veil was 63.5 football fields. About how many miles is th
    7·1 answer
  • When a figure is translated, reflected, or rotated, what's the same about the original
    15·2 answers
  • Answer the question 20. Y=x-3
    6·1 answer
  • What is the simplified form of the expression 0.3 (4x - 4y)?
    13·1 answer
  • . The regular price of a scooter is $89.99. The scooter is on sale for 20%
    7·1 answer
  • Find a linear and an exponential equation that matches f(2)=12 and f(4)=48
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!