1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
o-na [289]
3 years ago
10

It is estimated that _______________ of human DNA encodes protein. A) about fifty percent B) less than five percent C) more than

ninety-five percent D) between eighty-five to ninety-five percent
Biology
2 answers:
stealth61 [152]3 years ago
8 0
It is less than 5% just  got the question
Ksivusya [100]3 years ago
5 0
It is estimated that _______________ of human DNA encodes protein.between eighty-five to ninety-five percent
between eighty-five to ninety-five percent
You might be interested in
Earth is home to more than 20 million kinds of organisms, and all have DNA
marishachu [46]

Answer:B. Their DNA molecules have different numbers of strands.

Explanation:that is chromosome that make them to differ in diploid numbers thus differ generally and appear differently

7 0
3 years ago
Read 2 more answers
Match the statement with the correct term
Furkat [3]

Answer:

not too sure but a . . . . .. .

3 0
2 years ago
Bag of skin surrounding the testes is called​
AleksAgata [21]

Answer:

{ \pmb{it \: is \: called \: a \: scrotum}}

4 0
3 years ago
Read 2 more answers
A rose bush cell can divide to form two rose bushes.
julia-pushkina [17]
Is this a question or a statement?
4 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • What is the purpose of the structure of a spirillum?
    11·2 answers
  • Both aerobic and anaerobic respiration yield a net gain of ATP molecules to be used as energy for living things. The processes o
    5·1 answer
  • Tim lives in a city with an average rainfall of 30 millimeters per year. It has hot summers and cool winters. It is hottest duri
    11·2 answers
  • Tundra and desert biomes have shallow soil profiles because weathering is limited by a lack of
    8·2 answers
  • What would happen if a cell didn’t have a cytoskeleton
    15·1 answer
  • Fossil seashells have been found in rock beds on land. what can you infer about how the area has changed
    8·1 answer
  • What animal is called the ship of the desert
    10·2 answers
  • What is an advantage of using pluripotent cells instead of multipotent cells in
    7·2 answers
  • Nitrogen oxides from gas-burning cars and trucks that do not change form in the atmosphere are considered to be
    10·1 answer
  • William Shakespeare's writings are thought to be a perfect example of which of the following? A. The Reformation B. The Enlighte
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!