1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliya0001 [1]
3 years ago
6

A mutation in a G-protein prevents the alpha-subunit from dissociating from the beta/gamma-subunit. What effect will this have o

n the pathway in which the G-protein is involved?
Biology
1 answer:
Ymorist [56]3 years ago
8 0

Answer:

the pathway will be under-expressed.

  • the alpha subunit helps to bind with either GDP or GTP. when the α subunit is bound with GDP, it will be bound to β and γ subunits and thus forms an inactive state for G-protein.
  • when the alpha subunit binds with the GTP, it becomes activated and dissociates β and γ subunits.

if G-protein Coupled Receptor is unable from dissociating β and γ subunits, then the pathway will go under expression.  

The chemical qualities of the alpha subunit allow it to bind easily to one of two guanine subunits, GDP or GTP. The protein thus has two functional formations. When GDP is bound to the alpha subunit, the alpha subunit remains bound to the beta-gamma subunit to form an inactive trimeric protein.

G-proteins, cAMP, and Ion Channel Opening. The alpha subunit activates adenylate cyclase, in purple, and loses GTP. Adenylate cyclase converts ATP to cyclic AMP, which then activates Protein Kinase, shown in blue. Protein Kinase phosphorylates an ion channel, letting sodium ions rush into the cell.

As a result of the ligand binding to its site on the G-protein-linked receptor, A) the G-protein changes conformation and GTP replaces the GDP on the alpha subunit. ... Inactivation of the alpha subunit occurs when its own phosphorylase activity removes a phosphate from the GTP.

You might be interested in
A nurse is working with a group of patients. one patient states, "my goal is to reduce my weight from 280 pounds to 230 pounds i
kirill115 [55]
Its definitely not A or D because there are 26 weeks in 6 months.

generally, a weight loss of 1-2 lbs per week is reasonable and safe. 

I would say B because it is unrealistic that someone would always lose 2lbs a week
7 0
3 years ago
Read 2 more answers
A fertilizer producer finds that it can sell its product at a price of dollars per unit when it produces units of fertilizer. Th
Vilka [71]

Answer:

700

Explanation:

If from the question the price per unit of fertilizer, p(x) = 300 - 0.1x

The cost of x units of  fertilizer = C(x) = 15000 + 125x + 0.025x^2

And we know that Profit = Revenue - Cost

Revenue for x units of fertilizer R(X) = x*p(x)

= 300x - 0.1x^2

Hence Profit: P(x) = R(x) - C(x)

= [300x - 0.1x^2] - [15000 + 125x + 0.025x^2]  

= -0.125x^2 + 175x - 15000

To determine critical values

P'(x) = -0.25x + 175 = 0

Thus x = 175/0.25

x = 700

To maximize profit, the manufactures must produce 700 units of fertilizers

5 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
I need help please!! I don’t know how to do biology
Alex_Xolod [135]
1.  a. egg album, which is a translucent fluid, changes to opaque white solid after boiling 
2. b. 5-carbon sugar
3. fats, phospholipids and steroids

I hope this helps you out!!  <3
8 0
4 years ago
I need help on this please
Vsevolod [243]

Answer:

A

Explanation:

5 0
3 years ago
Other questions:
  • Biology! WILL MARK BRAINLIEST! WRITE THIS IN YOUR OWN WORDS PLEASE PAST DUE!!
    8·1 answer
  • incomplete dominance is seen in snapdragon. The allele that causes red flowers (F) is not completely dominant over the allele th
    12·2 answers
  • An ion channel that opens when neurotransmitter binds to it is called a __________-gated channel.
    11·2 answers
  • Before winter animals that hibernate often prepare by eating foods high in fat. How is this behavior helpful?
    11·1 answer
  • Can y’all tell me which ones I got wrong please. Thank you!!
    7·1 answer
  • The land and water ecosystems that provide the resources that a person uses and that neutralize that person’s wastes is part of
    14·1 answer
  • What is the difference between the cryosphere and the<br> hydrosphere?
    11·1 answer
  • precipitation _____. occurs equally all over the globe is the change in state from a gas to a liquid happens when ice changes in
    11·2 answers
  • In the body, the homeostasis of which element is related to properties of bone?
    8·1 answer
  • Anatomy and physiology:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!