1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
3 years ago
6

What are your thoughts on the big bang theory? do you have doubts, or do you agree with it?​

Biology
1 answer:
BabaBlast [244]3 years ago
3 0
I think it didn’t happen because a big bang couldn’t have created this beautiful constructed earth.
You might be interested in
An experiment is conducted to determine the effects of energy drinks on an individual’s heart rate groups A and B have matched f
Mariulka [41]

Answer:

Explanation: this is complicated

8 0
3 years ago
What directs the production of new proteins
Vedmedyk [2.9K]

Answer,

Ribosomes

Explanation,

Ribosomes are cell organelles which help to produce proteins.It contains RNA and DNA strands which help in formation of new proteins.The synthesis of proteins takes place in two stages  transcription and translation.Transcription takes the information encoded to the DNA and encodes it into mRNA which heads to the nucleus inthe cytoplasm.Translation mRNA works with a ribosome and tRNA to synthesize proteins.

7 0
3 years ago
When scientists examined the whales' stomachs', they found proof that the whales died from a poison produced by algae, but the w
pishuonlain [190]

Explanation:

Its stomach was filled eith 30 plastic bags, and many smaller pieces of plastic. ... The whale was emaciated, and scientists believe that the plastic had gathered in such an amount in its stomach that it had created a plug, stopping the digestive process.

The cause of death appears to be starvation, though that's under investigation. Many of the stranded whales in 2019 have been malnourished, said David Weller, a research wildlife biologist with NOAA's Southwest Fisheries Science Center in La Jolla, California.

6 0
3 years ago
Read 2 more answers
To participate in a designated driver program and be provided with complimentary nonalcoholic drinks you must meet certain crite
svet-max [94.6K]
<span>all of the above 2 there are many ways to consume </span>
6 0
3 years ago
Read 2 more answers
Green (G) is the dominant color for pods in pea plants. Yellow (g) is
Sladkaya [172]

Answer:

No, it is not

Explanation:

Heterozygous is Gg, and if the dominant gene is there, it masks the recessive one.

5 0
3 years ago
Other questions:
  • DNA is the nucleus is found in structures called
    15·1 answer
  • To protect endangered species from becoming extinct, it’s highly recommended to raise the animals in protected areas such as zoo
    13·1 answer
  • "Necessity is something in the mind, not in the objects." Explain what this means and what Hume’s reasons were for holding it.
    13·1 answer
  • Description of what is an ecosystem
    9·1 answer
  • What are the character of the eukaryotic cells
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A set of characteristics that defines individuals as boys and men or girls and women is called __________.
    6·1 answer
  • What is the difference between a biomass pyramid and a pyramid of numbers
    9·1 answer
  • How do the properties of water and the ability to modify the rates of chemical reactions enable living things to carry out funct
    14·1 answer
  • How does the slope of land or direction of<br> plowing affect how water runs over the land?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!