Answer:
DNA is divided into codons which are 3 bases long. Each codon codes for a specific amino acid or signals transcription to stop or start. Inserting or deleting one base pair changes how the DNA is read, so it will often alter the amino acids the DNA sequence produces. As a result, the protein made from the gene may not function properly.
Example:
AAT CGC CGA TGA
Delete the T from the first codon
AAC GCC GAT GA
The entire sequence is read differently ^
Answer:
The correct applications are A, B, C, F, G and H.
Explanation:
The technology named Recombinant DNA Technology in the example is a technology which involves the combining process of the DNA segments. This segment then can be inserted into another living cell to replicate in there by itself or it can be added or integrated to a chromosome and then put into the cell for replication. Given this ability to manipulate and replicate these modified DNA molecules, this technology can lead to;
- A: can be used to give the plants an advantage over certain diseases or bugs that prevent their growth.
- B: can be used to modify/isolate and understand the functions of genes.
- C: can be used to swap and modify genes in the human body, giving them different abilities.
- F: can be used to match the DNA samples taken from the crime scenes by trying different combinations and possibilities.
- G: can be used in pharmaceutical industry, for example, making the bacterias produce insulin hormones by modifying their DNA and using this for the people with diabetes.
- H: can be used in gene therapy which is a process where a person's DNA is altered and put back in their body to help them produce certain enzymes/hormones/proteins thus curing specific diseases.
I hope this answer helps.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
the answer is false the take trees for example their Renewable but where ruining out of them.
CTTAAGGAGCTC. You would get this answer because cytosine and guanine are pairs and thymine and adenine are pairs too.
