Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
10%, energy/food
Explanation:
As you progress, it goes to 10% of the previous amount of energy/food.
Hope this helps!!! PLZ MARK BRAINLIEST!!!!!!
Answer:
In relation to voltage-gated ion channels, when depolarization occurs, Na⁺ gates open while K⁺ gates remain closed.
Explanation:
Depolarization is a phenomenon that occurs in cells like neurons, and depends on the distribution of ions in extracellular spaces and intraceluar.
-
Na⁺ is a predominantly extracellular cation.
- K⁺ has a high intracellular concentration.
This distribution occurs when the membrane potential is at rest, with a negative intracellular value.
Depolarization involves opening the Na⁺ channels, so that this cation enters the intracellular space, causing a change in cell voltage. Increasing Na⁺ concentration in intracellular space progressively produces an action potential, resulting in an electrical signal.
While depolarization occurs, K⁺ channels remain closed, limiting the output of this cation to extracellular space, which would prevent the action potential from occurring.
Learn more:
brainly.com/question/4661368
Age causes the tree bark to darken
