1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zubka84 [21]
3 years ago
7

During transformation,

Biology
2 answers:
Elenna [48]3 years ago
6 0

B. a cell takes in DNA from outside the cell

nikitadnepr [17]3 years ago
3 0
<span>b. a cell takes in DNA from outside the cell.</span>
You might be interested in
Secretion of human chorionic gonadotropin (hcg) occurs during what time frame during pregnancy?
masha68 [24]
Secretion of human chorionic gonadotropin [HCG] only occur during pregnancy in the placenta. The concentration of this hormone increase rapidly during the first three months of pregnancy; the amount in the blood stream doubles every two to three days as the development of the placenta and embryo progress. The hormone reaches its maximum concentration peak around the sixth week of pregnancy and after this, its concentration decline.
3 0
3 years ago
what would occur if the pistil of the flower would not be sticky at the top? what would that mean for the reproduction of the fl
poizon [28]
No pollen will be able to stick to it
6 0
3 years ago
Which of the following is a skin sensory receptor for touch?
DaniilM [7]
The answer is B.Meissners corpuscle
4 0
3 years ago
The sound which does not have a pleasant sensation on the ear is<br>(1 Point)​
patriot [66]

Answer:

Tinnitus

Explanation:

6 0
3 years ago
How does increasing plant biomass (amount of plants) affect atmospheric CO
sleet_krkn [62]

Answer:

Since there are more plants more carbon dioxide is being removed because plants are carbon reservoirs.

Explanation:

3 0
3 years ago
Other questions:
  • If coal mining continues over the next 60 years what could happen?
    15·1 answer
  • Is this statement true or false? A spider is an arthropod. Like the other animals in the phylum, it has jointed legs, a segmente
    10·2 answers
  • suppose a shopping mall is built near a rabbit warren, leaving less land available for rabbits how will this affect the environm
    9·1 answer
  • Patrick is observing a stained slide of muscle tissue under a microscope. He observes alternating dark and light bands inside th
    12·1 answer
  • Good observations are not critical to scientific investigations.<br><br> True<br><br> False
    6·1 answer
  • Dehydration synthesis is a process in which
    9·1 answer
  • An organic compound formed is the dark reaction of photosynthesis is
    10·2 answers
  • The landscape of the Amazon rain forest has become more fragmented over the past half century. Thus, we would say that its _____
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • In studies of disease-discordant monozygotic twin pairs, one searches each pair for __________________, focusing on those areas
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!