1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali [406]
3 years ago
11

You are a botanist looking at the plant color in a new breed of Snapdragon. The two parent plants are Blue and Green and when yo

u cross them you make F1 plants that are Cyan in color (a light aqua color). The ratio of offspring is as follows: There were 42 plants with Blue flowers (R1), 39 plants with Green flowers (R2) and 86 plants with Cyan flowers. Is the number of your progeny consistent with a single-gene incomplete dominance inheritance pattern
Biology
1 answer:
irakobra [83]3 years ago
4 0

Answer:

Incomplete dominance is the inheritance pattern where the dominant allele did not mask the recessive allele completely and form a mix of both alleles. Here the inheritance is the incomplete inheritance. The ratio of F2 generation is 1:2:1.

Given:

R1R1 = 42

R2R2 = 39

R1R2 = 86

Total R1 alleles = 2*42+86 = 170

Total R2 alleles = 2*39+86 = 164

Total alleles = 334

Frequency of allele R1 = 170/334 = 0.51

Frequency of allele R2 = 164 / 334 = 0.49

Expected number of each phenotype:

Total population = 167

Blue = R1R1 = 0.51 * 0.51 * 167 = 43.44

Green = R2R2 = 0.49 * 0.49 * 167 = 40.10

Cyan = 2*R1*R2 = 2*0.51*0.49*167 = 83.46

Phenotype     Observed(O)    Expected (E)    O-E      (O-E)2     (O-E)2/E

Blue                 42                   43.44               -1.44       2.0736     0.0477

cyan                86                   83.46                 2.54     6.4516     0.0773

green              39                    40.1                    -1.1       1.2100      0.0302

Total              167                     167                                               0.1552

Chi-square value = 0.155

Degrees of freedom = no. of phenotypes – 1

Df = 3-1 = 2

Critical value = 5.99

Chi-square value of 0.155 is less than the critical value of 5.99. So we accept the null hypothesis.

You might be interested in
What is the role of chlorophyll is photosynthesis?
Alona [7]

Answer:

Chlorophyll's job is to obsorb sunlight into the plant to be able to use the process of photosynthesis! Answer is C

5 0
3 years ago
Gene expression control that occurred after the generation of RNA is (blank)?
VladimirAG [237]
After the generation of the RNA would indicate that 
C. It is controlled after transcription

Now it could also be translation (because that is after the protein is made) - but because your question asks specifically after the RNA is formed (that process is called transcription) that would indicate that your answer is C.
5 0
3 years ago
Read 2 more answers
The best equipped organisms survive true or false
babunello [35]

true true true true true true true true true

4 0
3 years ago
PLEASEE HELP.!! ILL GIVE BRAINLIEST.!! *EXTRA POINTS* DONT SKIP:((
JulsSmile [24]

Answer:

most likely b, a population is many living with each other and not just one species

7 0
3 years ago
Explain why the following statement is false:
harina [27]

Explanation:

Tall, perennial grasses and herds of grazing herbivores are inhabitants of tropical and temperate biomes and not desert biomes.

Deserts do not support the growth of perennial grasses and a sustained herd population.

  • A desert is an arid landscape with very little to no rainfall through the years.
  • Plants needs water to manufacture their food and live.
  • Since this condition is absent, they cannot thrive in such biomes.
  • Grazing herbivores needs a lot of grasses to satisfy their foraging and ruminant nature.
  • Since grasses are lacking, they cannot survive.

learn more:

Deserts and steppes brainly.com/question/6685795

#learnwithBrainly

5 0
3 years ago
Other questions:
  • What is a primary function of the body covering of terrestrial animals?
    11·1 answer
  • "On the Mode of Communication of Cholera" was a scientific text written by Dr. John Snow in 1855 about the disease cholera. Iden
    8·2 answers
  • What are three ways seeds are spread around?
    12·2 answers
  • PLEASE HELP ASAP!!! Imagine a rocket launching from earth and travelling to the moon. In which order would the rocket pass throu
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • I NEED AN HONEST ANSWER, PLS HELP!
    9·2 answers
  • Which of the following is a specialist species?
    8·2 answers
  • The big Island of Hawaii was formed by
    12·1 answer
  • When describing a community, a biologist would identify every
    9·1 answer
  • I have 10 minutes left
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!