1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
3 years ago
15

What is the best definition of a virus

Biology
1 answer:
Mice21 [21]3 years ago
6 0

Answer:

A virus is a microscopic infectious organism that has the ability to recreate/replicate itself with nothing but the cells that are living in another organism. Viruses have the ability to infect anything, from plants to animals to humans. You have much more of a chance of this being fatal (to any of these life forms) if you have heart problems or vitamin deficiency.

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Please answer this fast!!!!
Diano4ka-milaya [45]

Answer:

b

Explanation:

b

5 0
3 years ago
Read 2 more answers
The blood pressure in blood vessels decreases with the distance the blood travels, starting from when it was pumped out of the h
Alecsey [184]
Capillaries to veins to arteries
7 0
3 years ago
Which of the items listed below are consider charateristics of living only? (Choose 3)
LenaWriter [7]
All living things have cellular organization
5 0
3 years ago
The moon s phases are caused by
Sergeu [11.5K]

Answer:

The phases of the Moon depend on its position in relation to the Sun and Earth. As the Moon makes its way around the Earth, we see the bright parts of the Moon's surface at different angles.

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Where does meiosis take place in bryophytes
    15·1 answer
  • What would happen if a cell did not have mitochondrial
    9·2 answers
  • Indicate whether each of the following statements is true, false, or does not provide enough information for you to make a decis
    13·1 answer
  • How are monotremes different from other groups of mammals?
    8·1 answer
  • -give an animal that lives in mountain <br>-give 3 adaptations of this animal​
    9·1 answer
  • Compared to most other substances, a great deal of heat is needed to raise the temperature of water by a given amount. This is b
    11·1 answer
  • Steroid hormones bind to receptors in the nucleus of their target cells. cannot diffuse through cell membranes. remain in circul
    11·1 answer
  • Name an organism that acts as secondary<br> consumer and a tertiary consumer.
    9·1 answer
  • HELP PLEASEEEE ASAP.
    8·1 answer
  • What is the most popular gamefish in Florida
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!