1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mice21 [21]
3 years ago
12

when you swallow, does the epiglottis cover the opening of the trachea or the opening of the esophagus?

Biology
1 answer:
nekit [7.7K]3 years ago
3 0
<span>To summarize, when we swallow food, the food pushes on the soft palate, sealing off the nasal cavity and preventing food from entering the nose. The food then begins to slide down the esophagus. The swallowing reflex raises the larynx up under the epiglottis as the ball of food pushes down the epiglottis, sealing off the trachea; then the esophageal sphincter relaxes so the food passes through the esophagus. I hope this helps you! :D</span>
You might be interested in
What kind of body covering does a toad have?
den301095 [7]
It is covered in skin.

This skin excretes a mucous layer which keeps it moist and also acts in protecting the animal from pollutants.
7 0
3 years ago
PLEASE ANSWER ASAP AND FILL IN THE 3 BLANKS
Ulleksa [173]

Answer:

15,000 from green plants to rabbits

1,500 from rabbits to weasels

150 from weasels to eagles

Explanation:

10% of the energy is being passed on from one level to the next, it goes as 150,000 to 15,000 to 1,500 to 150 to 15 to 1.5 to 0.15 to 0.015 and so on.  (hint just move one zero to get the answer much easier)

5 0
2 years ago
A cross involving true-breeding, red snapdragons and true-breeding, white snapdragons produce all pink offspring because both ge
stiks02 [169]

Answer: The correct answer for the blanks are- 1) Dominant and 2) Blending of the trait.

Incomplete dominance produces a blend/ intermediate phenotype of both the parental phenotypes ( such as Pink snapdragon here) because none of the parental allele completely masks the effect of other.

As per the given information in the question, when true-breeding, red snapdragons are crossed with true-breeding white snapdragons, they produce pink colored offspring. This means that neither of the parental gene is dominant over the other.

When both are cross bred, they will represent a heterozygous state ( when alleles for both the snapdragons are present ), and they will produce an intermediate phenotype ( that is a blend of both the traits). This represents blending of the parental trait.





5 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Match the planets to its description, Jupiter, Saturn, Uranus, Neptune?
olga_2 [115]

Answer:

Jupiter, Saturn, Uranus, Neptune

Explanation:

Jupiter, Saturn, Uranus, Neptune

3 0
3 years ago
Other questions:
  • What is the "goal" of an element in bonding chemically (what does it need to do to be stable"
    10·1 answer
  • Which bone(s) of the human body differ in males and females? label one with a?
    7·1 answer
  • Features of plant cells that clearly make them different from animal cells are
    12·1 answer
  • How did Dinosaurs diminished from earth?​
    12·2 answers
  • Compare anaerobic and cellular respiration
    11·1 answer
  • What is the correct order <br> secondary succession
    12·2 answers
  • What is an allele? / plz anser this i will rate YOU
    9·2 answers
  • Why the edges of the leaves often have water droplets. What could be the reason for this?
    15·1 answer
  • How would Darwin’s explanation of long necks in giraffes differ from Jean Baptiste Lamarck’s explanation of the same trait?
    5·1 answer
  • CuCl2 + H2S → CuS + 2HCI
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!